Incidental Mutation 'R0733:Prl7a2'
ID67125
Institutional Source Beutler Lab
Gene Symbol Prl7a2
Ensembl Gene ENSMUSG00000046899
Gene Nameprolactin family 7, subfamily a, member 2
SynonymsPLP-F, Prlpf
MMRRC Submission 038914-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0733 (G1)
Quality Score214
Status Validated
Chromosome13
Chromosomal Location27658584-27668036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27662688 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 114 (E114G)
Ref Sequence ENSEMBL: ENSMUSP00000006660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006660]
Predicted Effect probably damaging
Transcript: ENSMUST00000006660
AA Change: E114G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006660
Gene: ENSMUSG00000046899
AA Change: E114G

DomainStartEndE-ValueType
Pfam:Hormone_1 17 244 6.9e-45 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,932 T1056S possibly damaging Het
Abl1 A G 2: 31,778,945 Y88C probably damaging Het
Acbd3 A G 1: 180,752,218 I476V possibly damaging Het
Apba2 T C 7: 64,750,164 I689T probably damaging Het
AU018091 A G 7: 3,159,161 Y362H probably damaging Het
Cdh26 T C 2: 178,486,931 S759P probably damaging Het
Clcc1 A G 3: 108,674,740 Q387R probably benign Het
Cobl C T 11: 12,365,167 G259R probably benign Het
Col4a1 C T 8: 11,218,934 R968Q possibly damaging Het
Ddr2 A G 1: 170,004,812 probably benign Het
Dera C A 6: 137,796,848 N201K probably damaging Het
Dsg1a A C 18: 20,338,668 E659A probably damaging Het
Dus2 G T 8: 106,046,070 probably null Het
Ears2 T A 7: 122,048,129 I311F possibly damaging Het
Eml4 T A 17: 83,454,464 M417K possibly damaging Het
Exosc4 A T 15: 76,329,416 M147L probably benign Het
Fam171a2 T A 11: 102,439,722 Y278F possibly damaging Het
Fastk A C 5: 24,443,923 H155Q probably null Het
Fem1b G T 9: 62,796,843 N378K possibly damaging Het
Fut11 C A 14: 20,695,359 Y119* probably null Het
Gatsl2 T C 5: 134,136,215 F208L possibly damaging Het
Gm6797 T C X: 8,645,149 noncoding transcript Het
Gstt4 T C 10: 75,817,314 D138G probably benign Het
Hprt G A X: 53,002,150 C66Y probably damaging Het
Inpp5d T A 1: 87,668,077 probably benign Het
Ints6l T A X: 56,501,748 S621T probably benign Het
Ints6l C G X: 56,504,812 A699G probably benign Het
Kctd3 A G 1: 188,997,050 probably benign Het
Kntc1 G T 5: 123,790,916 V1252L probably null Het
Lama5 A T 2: 180,180,718 M2854K possibly damaging Het
Lcn5 G T 2: 25,661,101 L187F probably damaging Het
Lrp3 A T 7: 35,202,120 L758M possibly damaging Het
Ltn1 T A 16: 87,412,507 I740F probably benign Het
Mcm5 A G 8: 75,127,248 K710R probably benign Het
Mllt10 A G 2: 18,203,766 probably benign Het
Nbr1 T A 11: 101,576,371 M864K probably benign Het
Nkiras2 T C 11: 100,624,932 probably null Het
Nlrp4d T A 7: 10,382,522 E144V probably benign Het
Nppc T C 1: 86,669,634 probably benign Het
Ormdl2 T A 10: 128,819,999 Q94L probably damaging Het
Paox G C 7: 140,127,527 D88H probably damaging Het
Papd4 T A 13: 93,155,039 Q365L probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Prss54 T C 8: 95,559,740 D235G possibly damaging Het
Rwdd3 T C 3: 121,171,607 M24V probably benign Het
Serpinb6e T A 13: 33,841,218 N30I probably benign Het
Sh3rf1 G A 8: 61,372,560 A530T probably benign Het
Slc28a1 T C 7: 81,124,900 I165T probably benign Het
Slco6d1 T A 1: 98,428,269 L143* probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx27 A G 3: 94,562,013 L7P probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
St8sia2 C T 7: 73,960,840 G232S probably benign Het
Sun1 A G 5: 139,231,163 H255R possibly damaging Het
Ube2k A G 5: 65,581,452 I95V probably damaging Het
Ube2m C A 7: 13,035,752 E126D probably damaging Het
Vmn2r27 A T 6: 124,192,188 M661K probably benign Het
Wdr47 A T 3: 108,618,623 D154V probably damaging Het
Zfp113 A G 5: 138,145,583 V135A probably benign Het
Other mutations in Prl7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Prl7a2 APN 13 27659208 missense probably damaging 0.98
IGL02424:Prl7a2 APN 13 27667970 missense probably null 0.08
IGL02734:Prl7a2 APN 13 27659207 missense probably benign 0.38
IGL02823:Prl7a2 APN 13 27662751 missense possibly damaging 0.95
PIT4260001:Prl7a2 UTSW 13 27659276 nonsense probably null
R1371:Prl7a2 UTSW 13 27662767 missense probably benign 0.01
R1778:Prl7a2 UTSW 13 27659271 missense probably damaging 0.98
R1857:Prl7a2 UTSW 13 27659180 nonsense probably null
R2063:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2064:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2065:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2067:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2068:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2176:Prl7a2 UTSW 13 27659106 missense probably benign 0.10
R2213:Prl7a2 UTSW 13 27665068 missense probably benign 0.06
R4111:Prl7a2 UTSW 13 27665067 missense possibly damaging 0.96
R4459:Prl7a2 UTSW 13 27665996 missense probably benign 0.21
R4483:Prl7a2 UTSW 13 27660947 missense possibly damaging 0.80
R4722:Prl7a2 UTSW 13 27660875 missense probably damaging 1.00
R5360:Prl7a2 UTSW 13 27659160 missense probably benign 0.22
R5778:Prl7a2 UTSW 13 27661000 nonsense probably null
R6667:Prl7a2 UTSW 13 27661041 missense probably benign 0.03
R7107:Prl7a2 UTSW 13 27659093 missense possibly damaging 0.89
R7600:Prl7a2 UTSW 13 27659281 missense possibly damaging 0.63
R8298:Prl7a2 UTSW 13 27661011 missense probably benign 0.00
R8447:Prl7a2 UTSW 13 27665958 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GTGGTCAGTGAGTGACATTTGCCTA -3'
(R):5'- AGACACTTCACCATTGTCTAGCTTTGTT -3'

Sequencing Primer
(F):5'- GGGACTTGATACAACATGACTTAAC -3'
(R):5'- AGGAGATGGACATTTATATGACAAAG -3'
Posted On2013-09-03