Incidental Mutation 'R8796:Slc35b3'
ID 671274
Institutional Source Beutler Lab
Gene Symbol Slc35b3
Ensembl Gene ENSMUSG00000021432
Gene Name solute carrier family 35, member B3
Synonyms 4921526O06Rik, PAPST2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock # R8796 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 38932136-38960875 bp(-) (GRCm38)
Type of Mutation critical splice donor site
DNA Base Change (assembly) C to T at 38937746 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021870] [ENSMUST00000167513] [ENSMUST00000224429] [ENSMUST00000224645] [ENSMUST00000225396] [ENSMUST00000225432] [ENSMUST00000225461] [ENSMUST00000225568] [ENSMUST00000225714]
AlphaFold Q922Q5
Predicted Effect probably benign
Transcript: ENSMUST00000021870
SMART Domains Protein: ENSMUSP00000021870
Gene: ENSMUSG00000021432

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:UAA 92 383 3.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167513
SMART Domains Protein: ENSMUSP00000126016
Gene: ENSMUSG00000021432

DomainStartEndE-ValueType
Pfam:UAA 49 343 4e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224429
Predicted Effect probably benign
Transcript: ENSMUST00000224645
Predicted Effect probably benign
Transcript: ENSMUST00000225396
Predicted Effect probably benign
Transcript: ENSMUST00000225432
Predicted Effect probably benign
Transcript: ENSMUST00000225461
Predicted Effect probably benign
Transcript: ENSMUST00000225568
Predicted Effect probably benign
Transcript: ENSMUST00000225714
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family. The encoded protein is involved in the transport of 3-prime phosphoadenosine 5-prime phosphosulfate (PAPS) from the nucleus or the cytosol to the Golgi lumen. This gene has been reported to be expressed preferentially in the human colon tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,629,482 T182S possibly damaging Het
Abca12 A C 1: 71,258,089 probably benign Het
Aco1 T A 4: 40,179,037 D345E probably benign Het
Acp6 T C 3: 97,159,193 V9A probably benign Het
Akap1 A C 11: 88,839,672 I597S probably damaging Het
B4galnt4 C T 7: 141,067,575 T385I probably damaging Het
Bbof1 A T 12: 84,413,294 T112S possibly damaging Het
Chd7 C A 4: 8,838,691 H1297N probably damaging Het
Cldn15 T C 5: 136,974,497 F147L probably damaging Het
Coq7 C T 7: 118,527,417 E143K probably damaging Het
Ctnnb1 A G 9: 120,955,432 N430S probably damaging Het
Cxcl12 G T 6: 117,178,592 K92N possibly damaging Het
Dscaml1 T C 9: 45,447,728 F95S probably damaging Het
Epha5 T A 5: 84,107,991 H480L probably damaging Het
Fbxo30 G A 10: 11,289,576 C14Y probably damaging Het
Gja5 A G 3: 97,051,103 I159V possibly damaging Het
Herc2 A T 7: 56,135,375 Q1487L probably benign Het
Hipk2 T A 6: 38,698,223 Q1168L probably damaging Het
Kcnk12 T A 17: 87,746,592 Y214F probably damaging Het
Kif5b T C 18: 6,226,965 K98E probably benign Het
Lama1 T A 17: 67,810,151 N2480K Het
Lrp1b A G 2: 40,903,414 C2610R Het
Mast4 T C 13: 102,783,391 Y536C probably benign Het
Ntrk1 A G 3: 87,783,115 S407P probably benign Het
Ogdh T A 11: 6,347,129 M527K possibly damaging Het
Olfr1036 G A 2: 86,075,174 V145M possibly damaging Het
Olfr65 T C 7: 103,906,994 V182A Het
Plxdc1 A G 11: 97,956,581 S89P probably benign Het
Prdm2 A G 4: 143,133,447 I1091T probably benign Het
Psg16 C A 7: 17,093,889 H166N possibly damaging Het
Qrfpr T A 3: 36,180,196 Y332F probably damaging Het
Rab31 A T 17: 65,772,534 I4K possibly damaging Het
Ranbp10 C A 8: 105,773,033 probably benign Het
Rasgrf2 T C 13: 91,890,566 S453G Het
Rxfp2 C T 5: 150,018,797 probably benign Het
S100a8 A G 3: 90,669,558 E6G probably damaging Het
Sart1 T C 19: 5,388,348 K94E probably damaging Het
Sema4d A T 13: 51,711,510 F297I probably damaging Het
Sgk2 A G 2: 163,006,803 K287E probably damaging Het
Sgsm1 T A 5: 113,263,257 T868S probably benign Het
Skint6 G T 4: 112,804,694 T1231K possibly damaging Het
Slf1 A T 13: 77,066,665 M634K probably benign Het
Slit2 A G 5: 48,302,848 D1424G probably benign Het
Snx21 G A 2: 164,786,829 V131I possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tas1r3 A G 4: 155,861,391 V516A probably benign Het
Tas2r120 A T 6: 132,657,118 R54S probably damaging Het
Tmem109 A T 19: 10,872,631 L99Q probably damaging Het
Tnfrsf1b A G 4: 145,219,915 S309P possibly damaging Het
Trav11 C T 14: 53,519,770 A85V probably benign Het
Trp53 G A 11: 69,589,608 R267H possibly damaging Het
Ttn G A 2: 76,822,970 R12631C possibly damaging Het
Vmn2r10 T A 5: 108,996,051 T678S possibly damaging Het
Vmn2r124 T C 17: 18,062,671 M209T possibly damaging Het
Vmn2r24 A T 6: 123,780,541 M123L probably benign Het
Wdr41 T G 13: 95,015,067 L245R possibly damaging Het
Wwp2 G T 8: 107,556,557 G814W probably null Het
Other mutations in Slc35b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Slc35b3 APN 13 38943140 missense possibly damaging 0.82
IGL02111:Slc35b3 APN 13 38955782 missense probably damaging 0.99
R0883:Slc35b3 UTSW 13 38937275 missense probably benign 0.09
R1170:Slc35b3 UTSW 13 38937331 missense probably benign 0.03
R1440:Slc35b3 UTSW 13 38954134 nonsense probably null
R1653:Slc35b3 UTSW 13 38955798 missense probably benign 0.02
R1900:Slc35b3 UTSW 13 38960611 critical splice donor site probably null
R3874:Slc35b3 UTSW 13 38943068 missense possibly damaging 0.66
R3897:Slc35b3 UTSW 13 38934763 missense probably benign 0.09
R4399:Slc35b3 UTSW 13 38937815 missense possibly damaging 0.95
R4937:Slc35b3 UTSW 13 38932911 missense possibly damaging 0.89
R4955:Slc35b3 UTSW 13 38932890 missense probably benign 0.08
R5034:Slc35b3 UTSW 13 38943158 missense probably damaging 1.00
R5770:Slc35b3 UTSW 13 38937758 missense probably damaging 0.98
R6155:Slc35b3 UTSW 13 38944596 missense probably damaging 1.00
R6663:Slc35b3 UTSW 13 38954136 missense probably damaging 0.99
R7701:Slc35b3 UTSW 13 38944635 missense probably benign 0.03
R8534:Slc35b3 UTSW 13 38944590 missense probably benign 0.17
R8950:Slc35b3 UTSW 13 38954121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTCCTGAGTGGCAATAAG -3'
(R):5'- TCGTAGCACAGATTTTGAGTAGG -3'

Sequencing Primer
(F):5'- TGGCAATAAGTCACTGCACAATG -3'
(R):5'- GTTAACTATGCTGTGTGTGCAAACC -3'
Posted On 2021-04-30