Incidental Mutation 'R8797:Acsm5'
ID 671310
Institutional Source Beutler Lab
Gene Symbol Acsm5
Ensembl Gene ENSMUSG00000030972
Gene Name acyl-CoA synthetase medium-chain family member 5
Synonyms C730027J19Rik
MMRRC Submission 068638-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # R8797 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119125354-119142583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 119137374 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 397 (P397T)
Ref Sequence ENSEMBL: ENSMUSP00000063416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066465] [ENSMUST00000207307] [ENSMUST00000207381] [ENSMUST00000207387] [ENSMUST00000207440] [ENSMUST00000207796] [ENSMUST00000207813]
AlphaFold Q8BGA8
Predicted Effect probably damaging
Transcript: ENSMUST00000066465
AA Change: P397T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063416
Gene: ENSMUSG00000030972
AA Change: P397T

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
Pfam:AMP-binding 65 477 2.9e-78 PFAM
Pfam:AMP-binding_C 485 565 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207307
Predicted Effect unknown
Transcript: ENSMUST00000207381
AA Change: H86Q
Predicted Effect probably benign
Transcript: ENSMUST00000207387
Predicted Effect probably damaging
Transcript: ENSMUST00000207440
AA Change: P397T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000207796
AA Change: P397T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000207813
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 C T 10: 61,106,781 (GRCm39) R113K probably benign Het
Baiap2 G A 11: 119,897,201 (GRCm39) V519I probably benign Het
Ccna1 C T 3: 54,953,069 (GRCm39) A233T probably benign Het
Cdon T C 9: 35,389,931 (GRCm39) Y862H probably damaging Het
Crygc C T 1: 65,111,030 (GRCm39) A86T probably benign Het
Cyb5d2 T G 11: 72,669,662 (GRCm39) N232T probably benign Het
Dnah14 C A 1: 181,465,412 (GRCm39) H1193N probably benign Het
Dnah17 T G 11: 117,992,201 (GRCm39) E1170A probably benign Het
Dnah7b A G 1: 46,162,806 (GRCm39) Y384C probably damaging Het
Fat4 G A 3: 39,053,278 (GRCm39) V4091I probably benign Het
Fbxl12 C A 9: 20,550,160 (GRCm39) R165L possibly damaging Het
G6pc2 A G 2: 69,050,441 (GRCm39) Y22C probably benign Het
Gpihbp1 A T 15: 75,469,828 (GRCm39) Q181L possibly damaging Het
H2bc4 C T 13: 23,868,552 (GRCm39) S113L probably damaging Het
Hhatl A T 9: 121,619,965 (GRCm39) probably benign Het
Iars1 C A 13: 49,841,738 (GRCm39) S75R probably benign Het
Igfn1 T A 1: 135,902,573 (GRCm39) I375F possibly damaging Het
Itih4 A G 14: 30,618,529 (GRCm39) I647V probably benign Het
Jmjd1c T A 10: 67,060,616 (GRCm39) C703S probably benign Het
L3mbtl2 C T 15: 81,569,615 (GRCm39) T619I possibly damaging Het
Lct T C 1: 128,231,684 (GRCm39) T722A possibly damaging Het
Meioc C T 11: 102,567,686 (GRCm39) Q827* probably null Het
Meis2 T C 2: 115,694,986 (GRCm39) S386G probably benign Het
Mroh8 T A 2: 157,071,876 (GRCm39) D543V probably damaging Het
Ms4a13 C T 19: 11,161,200 (GRCm39) R113H probably benign Het
Myrfl T C 10: 116,613,325 (GRCm39) Y826C probably benign Het
Nf1 T C 11: 79,366,711 (GRCm39) probably benign Het
Nrg3 A C 14: 38,093,243 (GRCm39) L542R probably benign Het
Or13j1 T C 4: 43,706,455 (GRCm39) T38A probably damaging Het
Or2y8 T A 11: 52,036,340 (GRCm39) T6S probably benign Het
Or6c65 T A 10: 129,603,674 (GRCm39) I103K probably damaging Het
Pcdh15 A G 10: 74,419,978 (GRCm39) N1212S probably damaging Het
Pcsk5 G A 19: 17,443,472 (GRCm39) T1229I probably benign Het
Pkd1l3 A T 8: 110,374,946 (GRCm39) H1483L probably benign Het
Polr3b T A 10: 84,532,879 (GRCm39) L840* probably null Het
Psd4 A T 2: 24,287,440 (GRCm39) R457S probably benign Het
Relch T C 1: 105,678,121 (GRCm39) S1149P possibly damaging Het
Rgs12 A G 5: 35,186,915 (GRCm39) S194G Het
Rps3 A G 7: 99,132,797 (GRCm39) probably null Het
Saxo4 T C 19: 10,455,602 (GRCm39) I216V probably benign Het
Sgcb G T 5: 73,793,036 (GRCm39) N255K probably benign Het
Sla2 A G 2: 156,717,799 (GRCm39) Y158H probably damaging Het
Sla2 G A 2: 156,717,823 (GRCm39) Q150* probably null Het
Slc12a2 T A 18: 58,012,455 (GRCm39) Y193N possibly damaging Het
Supt16 G T 14: 52,409,960 (GRCm39) T749K probably damaging Het
Uqcrc2 A G 7: 120,239,500 (GRCm39) E104G probably damaging Het
Vasp T C 7: 18,994,563 (GRCm39) N251S unknown Het
Vmn1r72 A G 7: 11,403,965 (GRCm39) M161T probably benign Het
Zc3h18 T C 8: 123,134,989 (GRCm39) probably benign Het
Zfp981 T A 4: 146,619,906 (GRCm39) L20* probably null Het
Other mutations in Acsm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Acsm5 APN 7 119,141,661 (GRCm39) critical splice donor site probably null
IGL01662:Acsm5 APN 7 119,137,511 (GRCm39) missense probably damaging 1.00
IGL02228:Acsm5 APN 7 119,131,089 (GRCm39) missense probably damaging 1.00
IGL02380:Acsm5 APN 7 119,136,509 (GRCm39) missense probably benign 0.05
IGL02709:Acsm5 APN 7 119,134,041 (GRCm39) nonsense probably null
P4717OSA:Acsm5 UTSW 7 119,131,195 (GRCm39) missense probably benign 0.12
R0506:Acsm5 UTSW 7 119,137,319 (GRCm39) nonsense probably null
R0518:Acsm5 UTSW 7 119,135,023 (GRCm39) missense possibly damaging 0.95
R0866:Acsm5 UTSW 7 119,140,123 (GRCm39) missense probably damaging 0.99
R1171:Acsm5 UTSW 7 119,140,075 (GRCm39) missense probably damaging 0.99
R2362:Acsm5 UTSW 7 119,127,649 (GRCm39) start gained probably benign
R2511:Acsm5 UTSW 7 119,129,677 (GRCm39) missense possibly damaging 0.80
R4670:Acsm5 UTSW 7 119,130,983 (GRCm39) splice site probably null
R4908:Acsm5 UTSW 7 119,137,314 (GRCm39) missense probably damaging 1.00
R4913:Acsm5 UTSW 7 119,133,566 (GRCm39) missense probably damaging 0.98
R5038:Acsm5 UTSW 7 119,134,034 (GRCm39) missense probably damaging 1.00
R5112:Acsm5 UTSW 7 119,136,502 (GRCm39) missense possibly damaging 0.95
R6337:Acsm5 UTSW 7 119,133,458 (GRCm39) missense probably benign 0.00
R6481:Acsm5 UTSW 7 119,134,104 (GRCm39) missense probably benign 0.02
R7268:Acsm5 UTSW 7 119,136,511 (GRCm39) missense probably benign 0.38
R7275:Acsm5 UTSW 7 119,136,511 (GRCm39) missense possibly damaging 0.81
R7509:Acsm5 UTSW 7 119,133,611 (GRCm39) missense probably benign
R7794:Acsm5 UTSW 7 119,137,352 (GRCm39) unclassified probably benign
R8021:Acsm5 UTSW 7 119,141,616 (GRCm39) missense possibly damaging 0.72
R8178:Acsm5 UTSW 7 119,141,618 (GRCm39) missense probably damaging 1.00
Z1088:Acsm5 UTSW 7 119,136,434 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTCATGAAGGCTTGTTTGC -3'
(R):5'- GATTCGGACAGCAATATTTCCCTC -3'

Sequencing Primer
(F):5'- GCTTGTTTGCCATGGAAAAGAC -3'
(R):5'- CCTCTTTTCCTGGAGGCAGG -3'
Posted On 2021-04-30