Incidental Mutation 'R8797:Acsm5'
ID671310
Institutional Source Beutler Lab
Gene Symbol Acsm5
Ensembl Gene ENSMUSG00000030972
Gene Nameacyl-CoA synthetase medium-chain family member 5
SynonymsC730027J19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R8797 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location119519463-119545551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119538151 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 397 (P397T)
Ref Sequence ENSEMBL: ENSMUSP00000063416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066465] [ENSMUST00000207307] [ENSMUST00000207381] [ENSMUST00000207387] [ENSMUST00000207440] [ENSMUST00000207796] [ENSMUST00000207813]
Predicted Effect probably damaging
Transcript: ENSMUST00000066465
AA Change: P397T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063416
Gene: ENSMUSG00000030972
AA Change: P397T

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
Pfam:AMP-binding 65 477 2.9e-78 PFAM
Pfam:AMP-binding_C 485 565 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207307
Predicted Effect unknown
Transcript: ENSMUST00000207381
AA Change: H86Q
Predicted Effect probably benign
Transcript: ENSMUST00000207387
Predicted Effect probably damaging
Transcript: ENSMUST00000207440
AA Change: P397T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000207796
AA Change: P397T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000207813
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,750,396 S1149P possibly damaging Het
Adamts14 C T 10: 61,271,002 R113K probably benign Het
Baiap2 G A 11: 120,006,375 V519I probably benign Het
Ccna1 C T 3: 55,045,648 A233T probably benign Het
Cdon T C 9: 35,478,635 Y862H probably damaging Het
Crygc C T 1: 65,071,871 A86T probably benign Het
Cyb5d2 T G 11: 72,778,836 N232T probably benign Het
Dnah14 C A 1: 181,637,847 H1193N probably benign Het
Dnah17 T G 11: 118,101,375 E1170A probably benign Het
Dnah7b A G 1: 46,123,646 Y384C probably damaging Het
Fat4 G A 3: 38,999,129 V4091I probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
G6pc2 A G 2: 69,220,097 Y22C probably benign Het
Gpihbp1 A T 15: 75,597,979 Q181L possibly damaging Het
Hhatl A T 9: 121,790,899 probably benign Het
Hist1h2bc C T 13: 23,684,569 S113L probably damaging Het
Iars C A 13: 49,688,262 S75R probably benign Het
Igfn1 T A 1: 135,974,835 I375F possibly damaging Het
Itih4 A G 14: 30,896,572 I647V probably benign Het
Jmjd1c T A 10: 67,224,837 C703S probably benign Het
L3mbtl2 C T 15: 81,685,414 T619I possibly damaging Het
Lct T C 1: 128,303,947 T722A possibly damaging Het
Meioc C T 11: 102,676,860 Q827* probably null Het
Meis2 T C 2: 115,864,505 S386G probably benign Het
Mroh8 T A 2: 157,229,956 D543V probably damaging Het
Ms4a13 C T 19: 11,183,836 R113H probably benign Het
Myrfl T C 10: 116,777,420 Y826C probably benign Het
Nf1 T C 11: 79,475,885 probably benign Het
Nrg3 A C 14: 38,371,286 L542R probably benign Het
Olfr1373 T A 11: 52,145,513 T6S probably benign Het
Olfr71 T C 4: 43,706,455 T38A probably damaging Het
Olfr808 T A 10: 129,767,805 I103K probably damaging Het
Pcdh15 A G 10: 74,584,146 N1212S probably damaging Het
Pcsk5 G A 19: 17,466,108 T1229I probably benign Het
Pkd1l3 A T 8: 109,648,314 H1483L probably benign Het
Polr3b T A 10: 84,697,015 L840* probably null Het
Ppp1r32 T C 19: 10,478,238 I216V probably benign Het
Psd4 A T 2: 24,397,428 R457S probably benign Het
Rgs12 A G 5: 35,029,571 S194G Het
Rps3 A G 7: 99,483,590 probably null Het
Sgcb G T 5: 73,635,693 N255K probably benign Het
Sla2 A G 2: 156,875,879 Y158H probably damaging Het
Sla2 G A 2: 156,875,903 Q150* probably null Het
Slc12a2 T A 18: 57,879,383 Y193N possibly damaging Het
Supt16 G T 14: 52,172,503 T749K probably damaging Het
Uqcrc2 A G 7: 120,640,277 E104G probably damaging Het
Vasp T C 7: 19,260,638 N251S unknown Het
Vmn1r72 A G 7: 11,670,038 M161T probably benign Het
Zc3h18 T C 8: 122,408,250 probably benign Het
Zfp981 T A 4: 146,535,449 L20* probably null Het
Other mutations in Acsm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Acsm5 APN 7 119542438 critical splice donor site probably null
IGL01662:Acsm5 APN 7 119538288 missense probably damaging 1.00
IGL02228:Acsm5 APN 7 119531866 missense probably damaging 1.00
IGL02380:Acsm5 APN 7 119537286 missense probably benign 0.05
IGL02709:Acsm5 APN 7 119534818 nonsense probably null
P4717OSA:Acsm5 UTSW 7 119531972 missense probably benign 0.12
R0506:Acsm5 UTSW 7 119538096 nonsense probably null
R0518:Acsm5 UTSW 7 119535800 missense possibly damaging 0.95
R0866:Acsm5 UTSW 7 119540900 missense probably damaging 0.99
R1171:Acsm5 UTSW 7 119540852 missense probably damaging 0.99
R2362:Acsm5 UTSW 7 119528426 start gained probably benign
R2511:Acsm5 UTSW 7 119530454 missense possibly damaging 0.80
R4670:Acsm5 UTSW 7 119531760 splice site probably null
R4908:Acsm5 UTSW 7 119538091 missense probably damaging 1.00
R4913:Acsm5 UTSW 7 119534343 missense probably damaging 0.98
R5038:Acsm5 UTSW 7 119534811 missense probably damaging 1.00
R5112:Acsm5 UTSW 7 119537279 missense possibly damaging 0.95
R6337:Acsm5 UTSW 7 119534235 missense probably benign 0.00
R6481:Acsm5 UTSW 7 119534881 missense probably benign 0.02
R7268:Acsm5 UTSW 7 119537288 missense probably benign 0.38
R7275:Acsm5 UTSW 7 119537288 missense possibly damaging 0.81
R7509:Acsm5 UTSW 7 119534388 missense probably benign
R7794:Acsm5 UTSW 7 119538129 unclassified probably benign
R8021:Acsm5 UTSW 7 119542393 missense possibly damaging 0.72
R8178:Acsm5 UTSW 7 119542395 missense probably damaging 1.00
Z1088:Acsm5 UTSW 7 119537211 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTCATGAAGGCTTGTTTGC -3'
(R):5'- GATTCGGACAGCAATATTTCCCTC -3'

Sequencing Primer
(F):5'- GCTTGTTTGCCATGGAAAAGAC -3'
(R):5'- CCTCTTTTCCTGGAGGCAGG -3'
Posted On2021-04-30