Incidental Mutation 'R8797:Polr3b'
ID 671319
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Name polymerase (RNA) III (DNA directed) polypeptide B
Synonyms RPC2, A330032P03Rik, 2700078H01Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8797 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 84622292-84727178 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 84697015 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 840 (L840*)
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
AlphaFold P59470
Predicted Effect probably null
Transcript: ENSMUST00000077175
AA Change: L840*
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: L840*

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,750,396 S1149P possibly damaging Het
Acsm5 C A 7: 119,538,151 P397T probably damaging Het
Adamts14 C T 10: 61,271,002 R113K probably benign Het
Baiap2 G A 11: 120,006,375 V519I probably benign Het
Ccna1 C T 3: 55,045,648 A233T probably benign Het
Cdon T C 9: 35,478,635 Y862H probably damaging Het
Crygc C T 1: 65,071,871 A86T probably benign Het
Cyb5d2 T G 11: 72,778,836 N232T probably benign Het
Dnah14 C A 1: 181,637,847 H1193N probably benign Het
Dnah17 T G 11: 118,101,375 E1170A probably benign Het
Dnah7b A G 1: 46,123,646 Y384C probably damaging Het
Fat4 G A 3: 38,999,129 V4091I probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
G6pc2 A G 2: 69,220,097 Y22C probably benign Het
Gpihbp1 A T 15: 75,597,979 Q181L possibly damaging Het
Hhatl A T 9: 121,790,899 probably benign Het
Hist1h2bc C T 13: 23,684,569 S113L probably damaging Het
Iars C A 13: 49,688,262 S75R probably benign Het
Igfn1 T A 1: 135,974,835 I375F possibly damaging Het
Itih4 A G 14: 30,896,572 I647V probably benign Het
Jmjd1c T A 10: 67,224,837 C703S probably benign Het
L3mbtl2 C T 15: 81,685,414 T619I possibly damaging Het
Lct T C 1: 128,303,947 T722A possibly damaging Het
Meioc C T 11: 102,676,860 Q827* probably null Het
Meis2 T C 2: 115,864,505 S386G probably benign Het
Mroh8 T A 2: 157,229,956 D543V probably damaging Het
Ms4a13 C T 19: 11,183,836 R113H probably benign Het
Myrfl T C 10: 116,777,420 Y826C probably benign Het
Nf1 T C 11: 79,475,885 probably benign Het
Nrg3 A C 14: 38,371,286 L542R probably benign Het
Olfr1373 T A 11: 52,145,513 T6S probably benign Het
Olfr71 T C 4: 43,706,455 T38A probably damaging Het
Olfr808 T A 10: 129,767,805 I103K probably damaging Het
Pcdh15 A G 10: 74,584,146 N1212S probably damaging Het
Pcsk5 G A 19: 17,466,108 T1229I probably benign Het
Pkd1l3 A T 8: 109,648,314 H1483L probably benign Het
Ppp1r32 T C 19: 10,478,238 I216V probably benign Het
Psd4 A T 2: 24,397,428 R457S probably benign Het
Rgs12 A G 5: 35,029,571 S194G Het
Rps3 A G 7: 99,483,590 probably null Het
Sgcb G T 5: 73,635,693 N255K probably benign Het
Sla2 A G 2: 156,875,879 Y158H probably damaging Het
Sla2 G A 2: 156,875,903 Q150* probably null Het
Slc12a2 T A 18: 57,879,383 Y193N possibly damaging Het
Supt16 G T 14: 52,172,503 T749K probably damaging Het
Uqcrc2 A G 7: 120,640,277 E104G probably damaging Het
Vasp T C 7: 19,260,638 N251S unknown Het
Vmn1r72 A G 7: 11,670,038 M161T probably benign Het
Zc3h18 T C 8: 122,408,250 probably benign Het
Zfp981 T A 4: 146,535,449 L20* probably null Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
pinhead UTSW 10 84655991 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R0890:Polr3b UTSW 10 84714336 missense probably benign 0.01
R1302:Polr3b UTSW 10 84632486 missense probably damaging 0.97
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1624:Polr3b UTSW 10 84679805 missense probably damaging 0.98
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5065:Polr3b UTSW 10 84632538 missense probably benign 0.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6787:Polr3b UTSW 10 84628625 critical splice acceptor site probably null
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
R7405:Polr3b UTSW 10 84684179 missense probably benign
R7456:Polr3b UTSW 10 84622491 missense probably benign
R7657:Polr3b UTSW 10 84655991 missense probably damaging 1.00
R8074:Polr3b UTSW 10 84713659 missense probably damaging 1.00
R8082:Polr3b UTSW 10 84656063 missense probably damaging 1.00
R8127:Polr3b UTSW 10 84679789 missense probably benign
R8676:Polr3b UTSW 10 84680387 missense probably benign 0.00
R8744:Polr3b UTSW 10 84628624 splice site probably benign
R8866:Polr3b UTSW 10 84695691 missense probably benign 0.14
R9006:Polr3b UTSW 10 84631833 missense probably benign 0.05
R9397:Polr3b UTSW 10 84631789 missense possibly damaging 0.93
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Z1177:Polr3b UTSW 10 84714293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGCTGTGTGATCTCCAG -3'
(R):5'- GGTACCCAAAGTTGCTCTTTC -3'

Sequencing Primer
(F):5'- GATCTCCAGTTCTAGTTCATTGGGC -3'
(R):5'- CTAGTTCTTTGGCGTATAAAGACTG -3'
Posted On 2021-04-30