Incidental Mutation 'R8797:Olfr1373'
ID 671322
Institutional Source Beutler Lab
Gene Symbol Olfr1373
Ensembl Gene ENSMUSG00000062204
Gene Name olfactory receptor 1373
Synonyms MOR256-69_p, GA_x6K02T2QP88-3283154-3284089
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8797 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 52144593-52145528 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52145513 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 6 (T6S)
Ref Sequence ENSEMBL: ENSMUSP00000077384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078264]
AlphaFold Q7TQT6
Predicted Effect probably benign
Transcript: ENSMUST00000078264
AA Change: T6S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077384
Gene: ENSMUSG00000062204
AA Change: T6S

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.7e-46 PFAM
Pfam:7tm_1 41 289 1.1e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,750,396 S1149P possibly damaging Het
Acsm5 C A 7: 119,538,151 P397T probably damaging Het
Adamts14 C T 10: 61,271,002 R113K probably benign Het
Baiap2 G A 11: 120,006,375 V519I probably benign Het
Ccna1 C T 3: 55,045,648 A233T probably benign Het
Cdon T C 9: 35,478,635 Y862H probably damaging Het
Crygc C T 1: 65,071,871 A86T probably benign Het
Cyb5d2 T G 11: 72,778,836 N232T probably benign Het
Dnah14 C A 1: 181,637,847 H1193N probably benign Het
Dnah17 T G 11: 118,101,375 E1170A probably benign Het
Dnah7b A G 1: 46,123,646 Y384C probably damaging Het
Fat4 G A 3: 38,999,129 V4091I probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
G6pc2 A G 2: 69,220,097 Y22C probably benign Het
Gpihbp1 A T 15: 75,597,979 Q181L possibly damaging Het
Hhatl A T 9: 121,790,899 probably benign Het
Hist1h2bc C T 13: 23,684,569 S113L probably damaging Het
Iars C A 13: 49,688,262 S75R probably benign Het
Igfn1 T A 1: 135,974,835 I375F possibly damaging Het
Itih4 A G 14: 30,896,572 I647V probably benign Het
Jmjd1c T A 10: 67,224,837 C703S probably benign Het
L3mbtl2 C T 15: 81,685,414 T619I possibly damaging Het
Lct T C 1: 128,303,947 T722A possibly damaging Het
Meioc C T 11: 102,676,860 Q827* probably null Het
Meis2 T C 2: 115,864,505 S386G probably benign Het
Mroh8 T A 2: 157,229,956 D543V probably damaging Het
Ms4a13 C T 19: 11,183,836 R113H probably benign Het
Myrfl T C 10: 116,777,420 Y826C probably benign Het
Nf1 T C 11: 79,475,885 probably benign Het
Nrg3 A C 14: 38,371,286 L542R probably benign Het
Olfr71 T C 4: 43,706,455 T38A probably damaging Het
Olfr808 T A 10: 129,767,805 I103K probably damaging Het
Pcdh15 A G 10: 74,584,146 N1212S probably damaging Het
Pcsk5 G A 19: 17,466,108 T1229I probably benign Het
Pkd1l3 A T 8: 109,648,314 H1483L probably benign Het
Polr3b T A 10: 84,697,015 L840* probably null Het
Ppp1r32 T C 19: 10,478,238 I216V probably benign Het
Psd4 A T 2: 24,397,428 R457S probably benign Het
Rgs12 A G 5: 35,029,571 S194G Het
Rps3 A G 7: 99,483,590 probably null Het
Sgcb G T 5: 73,635,693 N255K probably benign Het
Sla2 G A 2: 156,875,903 Q150* probably null Het
Sla2 A G 2: 156,875,879 Y158H probably damaging Het
Slc12a2 T A 18: 57,879,383 Y193N possibly damaging Het
Supt16 G T 14: 52,172,503 T749K probably damaging Het
Uqcrc2 A G 7: 120,640,277 E104G probably damaging Het
Vasp T C 7: 19,260,638 N251S unknown Het
Vmn1r72 A G 7: 11,670,038 M161T probably benign Het
Zc3h18 T C 8: 122,408,250 probably benign Het
Zfp981 T A 4: 146,535,449 L20* probably null Het
Other mutations in Olfr1373
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02277:Olfr1373 APN 11 52145362 missense probably damaging 0.97
IGL02814:Olfr1373 APN 11 52144810 missense probably damaging 1.00
R0490:Olfr1373 UTSW 11 52144666 missense probably damaging 1.00
R1075:Olfr1373 UTSW 11 52144850 missense possibly damaging 0.94
R4050:Olfr1373 UTSW 11 52145134 missense probably damaging 1.00
R5666:Olfr1373 UTSW 11 52144698 nonsense probably null
R6267:Olfr1373 UTSW 11 52144596 missense probably benign 0.28
R6296:Olfr1373 UTSW 11 52144596 missense probably benign 0.28
R6720:Olfr1373 UTSW 11 52144693 missense probably benign 0.18
R6887:Olfr1373 UTSW 11 52145352 missense probably benign 0.01
V1662:Olfr1373 UTSW 11 52145177 missense probably damaging 1.00
X0066:Olfr1373 UTSW 11 52145264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTAGTACATGAGTGTGTGCAG -3'
(R):5'- TCGTGTCTCTAGCTGCATATGTAG -3'

Sequencing Primer
(F):5'- ATGAGTGTGTGCAGGCGGAG -3'
(R):5'- AGATGGCCTAGTCAGCCATCATTG -3'
Posted On 2021-04-30