Incidental Mutation 'R8797:Meioc'
ID 671325
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms Gm1564, LOC380729, LOC268491
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock # R8797 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102663716-102682237 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 102676860 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 827 (Q827*)
Ref Sequence ENSEMBL: ENSMUSP00000097947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect probably null
Transcript: ENSMUST00000100378
AA Change: Q827*
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: Q827*

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156590
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,750,396 S1149P possibly damaging Het
Acsm5 C A 7: 119,538,151 P397T probably damaging Het
Adamts14 C T 10: 61,271,002 R113K probably benign Het
Baiap2 G A 11: 120,006,375 V519I probably benign Het
Ccna1 C T 3: 55,045,648 A233T probably benign Het
Cdon T C 9: 35,478,635 Y862H probably damaging Het
Crygc C T 1: 65,071,871 A86T probably benign Het
Cyb5d2 T G 11: 72,778,836 N232T probably benign Het
Dnah14 C A 1: 181,637,847 H1193N probably benign Het
Dnah17 T G 11: 118,101,375 E1170A probably benign Het
Dnah7b A G 1: 46,123,646 Y384C probably damaging Het
Fat4 G A 3: 38,999,129 V4091I probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
G6pc2 A G 2: 69,220,097 Y22C probably benign Het
Gpihbp1 A T 15: 75,597,979 Q181L possibly damaging Het
Hhatl A T 9: 121,790,899 probably benign Het
Hist1h2bc C T 13: 23,684,569 S113L probably damaging Het
Iars C A 13: 49,688,262 S75R probably benign Het
Igfn1 T A 1: 135,974,835 I375F possibly damaging Het
Itih4 A G 14: 30,896,572 I647V probably benign Het
Jmjd1c T A 10: 67,224,837 C703S probably benign Het
L3mbtl2 C T 15: 81,685,414 T619I possibly damaging Het
Lct T C 1: 128,303,947 T722A possibly damaging Het
Meis2 T C 2: 115,864,505 S386G probably benign Het
Mroh8 T A 2: 157,229,956 D543V probably damaging Het
Ms4a13 C T 19: 11,183,836 R113H probably benign Het
Myrfl T C 10: 116,777,420 Y826C probably benign Het
Nf1 T C 11: 79,475,885 probably benign Het
Nrg3 A C 14: 38,371,286 L542R probably benign Het
Olfr1373 T A 11: 52,145,513 T6S probably benign Het
Olfr71 T C 4: 43,706,455 T38A probably damaging Het
Olfr808 T A 10: 129,767,805 I103K probably damaging Het
Pcdh15 A G 10: 74,584,146 N1212S probably damaging Het
Pcsk5 G A 19: 17,466,108 T1229I probably benign Het
Pkd1l3 A T 8: 109,648,314 H1483L probably benign Het
Polr3b T A 10: 84,697,015 L840* probably null Het
Ppp1r32 T C 19: 10,478,238 I216V probably benign Het
Psd4 A T 2: 24,397,428 R457S probably benign Het
Rgs12 A G 5: 35,029,571 S194G Het
Rps3 A G 7: 99,483,590 probably null Het
Sgcb G T 5: 73,635,693 N255K probably benign Het
Sla2 G A 2: 156,875,903 Q150* probably null Het
Sla2 A G 2: 156,875,879 Y158H probably damaging Het
Slc12a2 T A 18: 57,879,383 Y193N possibly damaging Het
Supt16 G T 14: 52,172,503 T749K probably damaging Het
Uqcrc2 A G 7: 120,640,277 E104G probably damaging Het
Vasp T C 7: 19,260,638 N251S unknown Het
Vmn1r72 A G 7: 11,670,038 M161T probably benign Het
Zc3h18 T C 8: 122,408,250 probably benign Het
Zfp981 T A 4: 146,535,449 L20* probably null Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102674287 missense probably benign 0.33
IGL01952:Meioc APN 11 102672185 missense possibly damaging 0.79
IGL02006:Meioc APN 11 102674266 missense probably damaging 1.00
IGL02195:Meioc APN 11 102674857 missense possibly damaging 0.91
IGL02339:Meioc APN 11 102668448 missense probably benign 0.18
IGL02935:Meioc APN 11 102672191 missense probably benign 0.06
IGL03294:Meioc APN 11 102680669 missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102679957 missense probably damaging 1.00
R0285:Meioc UTSW 11 102672191 missense probably benign 0.06
R0964:Meioc UTSW 11 102680031 missense probably damaging 1.00
R1074:Meioc UTSW 11 102675393 missense probably damaging 1.00
R2024:Meioc UTSW 11 102675358 missense probably benign 0.00
R4012:Meioc UTSW 11 102675828 missense probably damaging 0.99
R4429:Meioc UTSW 11 102675720 missense probably damaging 1.00
R4491:Meioc UTSW 11 102674920 missense possibly damaging 0.84
R4594:Meioc UTSW 11 102674166 missense probably damaging 1.00
R4752:Meioc UTSW 11 102674433 missense probably benign 0.00
R5301:Meioc UTSW 11 102680045 missense probably damaging 1.00
R5352:Meioc UTSW 11 102675313 missense probably benign 0.03
R5646:Meioc UTSW 11 102675257 missense possibly damaging 0.94
R5958:Meioc UTSW 11 102675153 missense probably benign 0.41
R5968:Meioc UTSW 11 102675831 missense probably damaging 0.99
R6157:Meioc UTSW 11 102668401 missense probably damaging 1.00
R6410:Meioc UTSW 11 102675034 missense probably benign 0.00
R6644:Meioc UTSW 11 102668460 critical splice donor site probably null
R7285:Meioc UTSW 11 102666342 missense probably benign 0.00
R7440:Meioc UTSW 11 102674237 missense possibly damaging 0.67
R7815:Meioc UTSW 11 102675588 missense probably damaging 1.00
R7984:Meioc UTSW 11 102674606 missense possibly damaging 0.94
R8009:Meioc UTSW 11 102676743 missense probably damaging 1.00
R8078:Meioc UTSW 11 102668400 nonsense probably null
R8195:Meioc UTSW 11 102675067 nonsense probably null
R8429:Meioc UTSW 11 102674206 missense probably benign 0.06
R8854:Meioc UTSW 11 102675763 missense probably damaging 0.98
R8891:Meioc UTSW 11 102668420 missense probably benign 0.43
R9081:Meioc UTSW 11 102674175 missense probably benign 0.00
R9360:Meioc UTSW 11 102674953 missense probably benign 0.13
Z1177:Meioc UTSW 11 102666364 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACCAAGTAACTTCTATTTCTTAGAGT -3'
(R):5'- AACACGAATTTATTTGAGCTGTGTT -3'

Sequencing Primer
(F):5'- CTGAATTAGCCCTTGCCAA -3'
(R):5'- GTGGCCTCAATGTGCACATAC -3'
Posted On 2021-04-30