Incidental Mutation 'R8797:Supt16'
ID 671332
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name suppressor of Ty 16
Synonyms Supt16h, Spt16, Fact140, Cdc68
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R8797 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 52160414-52197416 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 52172503 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 749 (T749K)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: T749K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: T749K

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.7787 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,750,396 S1149P possibly damaging Het
Acsm5 C A 7: 119,538,151 P397T probably damaging Het
Adamts14 C T 10: 61,271,002 R113K probably benign Het
Baiap2 G A 11: 120,006,375 V519I probably benign Het
Ccna1 C T 3: 55,045,648 A233T probably benign Het
Cdon T C 9: 35,478,635 Y862H probably damaging Het
Crygc C T 1: 65,071,871 A86T probably benign Het
Cyb5d2 T G 11: 72,778,836 N232T probably benign Het
Dnah14 C A 1: 181,637,847 H1193N probably benign Het
Dnah17 T G 11: 118,101,375 E1170A probably benign Het
Dnah7b A G 1: 46,123,646 Y384C probably damaging Het
Fat4 G A 3: 38,999,129 V4091I probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
G6pc2 A G 2: 69,220,097 Y22C probably benign Het
Gpihbp1 A T 15: 75,597,979 Q181L possibly damaging Het
Hhatl A T 9: 121,790,899 probably benign Het
Hist1h2bc C T 13: 23,684,569 S113L probably damaging Het
Iars C A 13: 49,688,262 S75R probably benign Het
Igfn1 T A 1: 135,974,835 I375F possibly damaging Het
Itih4 A G 14: 30,896,572 I647V probably benign Het
Jmjd1c T A 10: 67,224,837 C703S probably benign Het
L3mbtl2 C T 15: 81,685,414 T619I possibly damaging Het
Lct T C 1: 128,303,947 T722A possibly damaging Het
Meioc C T 11: 102,676,860 Q827* probably null Het
Meis2 T C 2: 115,864,505 S386G probably benign Het
Mroh8 T A 2: 157,229,956 D543V probably damaging Het
Ms4a13 C T 19: 11,183,836 R113H probably benign Het
Myrfl T C 10: 116,777,420 Y826C probably benign Het
Nf1 T C 11: 79,475,885 probably benign Het
Nrg3 A C 14: 38,371,286 L542R probably benign Het
Olfr1373 T A 11: 52,145,513 T6S probably benign Het
Olfr71 T C 4: 43,706,455 T38A probably damaging Het
Olfr808 T A 10: 129,767,805 I103K probably damaging Het
Pcdh15 A G 10: 74,584,146 N1212S probably damaging Het
Pcsk5 G A 19: 17,466,108 T1229I probably benign Het
Pkd1l3 A T 8: 109,648,314 H1483L probably benign Het
Polr3b T A 10: 84,697,015 L840* probably null Het
Ppp1r32 T C 19: 10,478,238 I216V probably benign Het
Psd4 A T 2: 24,397,428 R457S probably benign Het
Rgs12 A G 5: 35,029,571 S194G Het
Rps3 A G 7: 99,483,590 probably null Het
Sgcb G T 5: 73,635,693 N255K probably benign Het
Sla2 A G 2: 156,875,879 Y158H probably damaging Het
Sla2 G A 2: 156,875,903 Q150* probably null Het
Slc12a2 T A 18: 57,879,383 Y193N possibly damaging Het
Uqcrc2 A G 7: 120,640,277 E104G probably damaging Het
Vasp T C 7: 19,260,638 N251S unknown Het
Vmn1r72 A G 7: 11,670,038 M161T probably benign Het
Zc3h18 T C 8: 122,408,250 probably benign Het
Zfp981 T A 4: 146,535,449 L20* probably null Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
R9048:Supt16 UTSW 14 52181056 missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- ATGCACTGGCTCAGCAGA -3'
(R):5'- TACATAGCTGCCTTGAGGTCA -3'

Sequencing Primer
(F):5'- GAGCAGACACTAACGTTACTTG -3'
(R):5'- GATATGAGCCTCAATTCCAGTCAGG -3'
Posted On 2021-04-30