Incidental Mutation 'R8798:Xrcc5'
ID 671339
Institutional Source Beutler Lab
Gene Symbol Xrcc5
Ensembl Gene ENSMUSG00000026187
Gene Name X-ray repair complementing defective repair in Chinese hamster cells 5
Synonyms Ku86, Ku80
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8798 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 72307421-72394952 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72314178 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 115 (M115T)
Ref Sequence ENSEMBL: ENSMUSP00000027379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027379]
AlphaFold P27641
Predicted Effect probably damaging
Transcript: ENSMUST00000027379
AA Change: M115T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027379
Gene: ENSMUSG00000026187
AA Change: M115T

DomainStartEndE-ValueType
VWA 7 245 8.07e-2 SMART
Ku78 302 441 8.9e-52 SMART
Pfam:Ku_C 476 570 6.9e-23 PFAM
Pfam:Ku_PK_bind 594 707 9.3e-31 PFAM
Meta Mutation Damage Score 0.7172 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants are defective in DNA double-strand break repair and show impaired growth and severe combined immunodeficiency due to defective assembly of TCRs and immunoglobulins. Mutants die early with osteopenia, atrophic skin and hepatic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik G A 8: 79,210,751 R176* probably null Het
2610044O15Rik8 G A 8: 129,219,298 H349Y probably damaging Het
4921539E11Rik A C 4: 103,266,377 probably benign Het
A430078G23Rik T A 8: 3,364,645 Y8N probably benign Het
Abcc2 A G 19: 43,808,666 N492S probably benign Het
Acox1 T C 11: 116,174,357 Y624C probably damaging Het
Aff4 T C 11: 53,400,508 probably benign Het
Ak9 T A 10: 41,382,851 D781E Het
Arfgef3 T C 10: 18,647,051 D409G probably damaging Het
Blnk A G 19: 40,962,351 Y119H probably damaging Het
Brsk2 T C 7: 141,987,864 L310P probably damaging Het
Cit T A 5: 115,969,043 L1078Q probably damaging Het
Cpn1 A T 19: 43,986,236 V18D possibly damaging Het
Csmd3 A T 15: 47,731,986 Y1115N Het
Dnah9 A C 11: 65,905,231 V3589G probably damaging Het
Dpp9 T C 17: 56,199,037 Y454C probably damaging Het
Eif3i A G 4: 129,596,924 V67A probably benign Het
Eif6 T C 2: 155,822,966 N200S probably damaging Het
Fbxo10 T C 4: 45,051,605 H502R possibly damaging Het
Fcer1a A G 1: 173,225,480 Y50H probably benign Het
Filip1 G A 9: 79,820,090 H416Y possibly damaging Het
Frmpd1 A T 4: 45,285,424 N1415I possibly damaging Het
Gdpgp1 C T 7: 80,238,977 P252L probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gsap T C 5: 21,271,250 probably null Het
Hgs T C 11: 120,480,112 V598A probably benign Het
Irf2 G T 8: 46,807,314 V94L probably benign Het
Kalrn G T 16: 33,982,855 H2675Q possibly damaging Het
Klhl33 C A 14: 50,893,108 A50S possibly damaging Het
Klk1b11 T C 7: 43,995,948 I15T probably benign Het
Lrrn3 A G 12: 41,453,175 M381T possibly damaging Het
Ltbr A G 6: 125,307,295 Y395H probably benign Het
Ltf A G 9: 111,023,760 probably benign Het
Ly75 A G 2: 60,323,926 F1059S probably benign Het
Lypd6 T A 2: 50,188,762 I90N possibly damaging Het
Map1a G A 2: 121,302,287 V1195M probably benign Het
Mb21d1 G A 9: 78,443,066 R5C probably benign Het
Mroh2b A T 15: 4,948,709 I1320F probably damaging Het
Mug2 A G 6: 122,081,610 T1324A probably damaging Het
Mylk G A 16: 34,899,402 V562M possibly damaging Het
Myo15b G A 11: 115,863,406 G911R Het
Neo1 A G 9: 58,913,166 Y825H probably damaging Het
Nfat5 T G 8: 107,347,689 V343G probably damaging Het
Nlrp2 A T 7: 5,327,888 I503K possibly damaging Het
Olfr180 A T 16: 58,915,944 D232E probably benign Het
Olfr270 C A 4: 52,970,790 H56Q possibly damaging Het
Olfr924 G A 9: 38,848,917 E268K probably benign Het
Olfr975 G A 9: 39,950,717 T18I probably benign Het
Pdcl2 T C 5: 76,325,100 D7G probably damaging Het
Phyh C T 2: 4,919,082 R5C probably damaging Het
Prr11 A C 11: 87,106,055 S28A unknown Het
Psmd13 T A 7: 140,897,750 L190* probably null Het
Ptx4 A G 17: 25,124,742 D322G probably damaging Het
Rnf40 T C 7: 127,589,782 L109P probably damaging Het
Rrp1 T C 10: 78,409,190 T102A probably damaging Het
Sema4a T G 3: 88,436,697 D749A possibly damaging Het
Serpina3f A T 12: 104,217,443 D188V probably benign Het
Smarca5 C A 8: 80,716,508 A570S probably damaging Het
Spocd1 G C 4: 129,930,204 probably null Het
Stard9 G A 2: 120,704,731 G3823D probably benign Het
Suco A G 1: 161,820,435 L1094S probably damaging Het
Tcf7 T C 11: 52,260,594 D79G probably damaging Het
Tdrd12 A G 7: 35,529,180 M39T probably damaging Het
Thnsl1 A G 2: 21,212,398 N321S probably benign Het
Tmem132c T A 5: 127,360,153 Y235* probably null Het
Tnfaip6 T C 2: 52,043,812 F60L probably benign Het
Tnpo3 T C 6: 29,572,621 I411V probably benign Het
Trio A C 15: 27,851,837 V856G possibly damaging Het
Trpc2 C G 7: 102,084,560 R239G probably benign Het
Ttn C T 2: 76,826,132 V12502I unknown Het
Usf3 A G 16: 44,220,173 D1672G probably damaging Het
Usp24 A G 4: 106,379,239 N1011S probably benign Het
Vac14 A G 8: 110,719,887 E756G probably benign Het
Vmn2r41 A G 7: 8,161,523 L10P probably damaging Het
Zfp827 G A 8: 79,189,834 probably benign Het
Zmym1 A T 4: 127,049,871 N241K possibly damaging Het
Other mutations in Xrcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Xrcc5 APN 1 72354245 missense probably benign 0.01
IGL01599:Xrcc5 APN 1 72346349 missense possibly damaging 0.72
IGL01714:Xrcc5 APN 1 72329984 missense probably damaging 0.98
IGL02740:Xrcc5 APN 1 72340081 critical splice donor site probably null
IGL02884:Xrcc5 APN 1 72346237 missense possibly damaging 0.95
barbarian UTSW 1 72314178 missense probably damaging 1.00
durio UTSW 1 72339029 missense probably damaging 1.00
Highlander UTSW 1 72319127 missense possibly damaging 0.55
R6935_Xrcc5_229 UTSW 1 72343030 missense possibly damaging 0.82
xenophobe UTSW 1 72312436 missense probably damaging 1.00
zibethinus UTSW 1 72310458 missense probably damaging 1.00
PIT4362001:Xrcc5 UTSW 1 72393929 missense probably benign
R0309:Xrcc5 UTSW 1 72307576 unclassified probably benign
R0485:Xrcc5 UTSW 1 72338945 splice site probably benign
R1004:Xrcc5 UTSW 1 72383778 splice site probably benign
R1421:Xrcc5 UTSW 1 72310477 missense probably benign 0.00
R1530:Xrcc5 UTSW 1 72329944 missense probably damaging 0.98
R1694:Xrcc5 UTSW 1 72319096 missense possibly damaging 0.88
R1750:Xrcc5 UTSW 1 72325087 nonsense probably null
R2037:Xrcc5 UTSW 1 72346370 missense probably benign 0.01
R2296:Xrcc5 UTSW 1 72346326 missense probably benign 0.00
R4299:Xrcc5 UTSW 1 72394720 makesense probably null
R4388:Xrcc5 UTSW 1 72330030 missense possibly damaging 0.46
R4527:Xrcc5 UTSW 1 72312500 missense probably damaging 1.00
R4857:Xrcc5 UTSW 1 72326265 missense possibly damaging 0.92
R5073:Xrcc5 UTSW 1 72339029 missense probably damaging 1.00
R5233:Xrcc5 UTSW 1 72340050 missense probably damaging 1.00
R5521:Xrcc5 UTSW 1 72346271 missense probably damaging 1.00
R5996:Xrcc5 UTSW 1 72310458 missense probably damaging 1.00
R6583:Xrcc5 UTSW 1 72312593 critical splice donor site probably null
R6638:Xrcc5 UTSW 1 72383362 missense possibly damaging 0.94
R6935:Xrcc5 UTSW 1 72343030 missense possibly damaging 0.82
R7046:Xrcc5 UTSW 1 72394716 missense probably benign 0.00
R7446:Xrcc5 UTSW 1 72393973 splice site probably null
R7473:Xrcc5 UTSW 1 72312589 missense probably damaging 1.00
R7875:Xrcc5 UTSW 1 72329931 missense probably damaging 1.00
R7889:Xrcc5 UTSW 1 72356826 missense probably benign 0.45
R8088:Xrcc5 UTSW 1 72312436 missense probably damaging 1.00
R8179:Xrcc5 UTSW 1 72356857 missense probably damaging 0.99
R8297:Xrcc5 UTSW 1 72325085 missense possibly damaging 0.47
R8309:Xrcc5 UTSW 1 72319127 missense possibly damaging 0.55
R8717:Xrcc5 UTSW 1 72383746 missense probably benign
R8775:Xrcc5 UTSW 1 72393930 missense probably benign 0.01
R8775-TAIL:Xrcc5 UTSW 1 72393930 missense probably benign 0.01
R8889:Xrcc5 UTSW 1 72343031 missense possibly damaging 0.90
R8892:Xrcc5 UTSW 1 72343031 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TAGAGTCTGGGACACATGGG -3'
(R):5'- GTACAGCACACCAACTACTTATGG -3'

Sequencing Primer
(F):5'- GGCAAGCCCTTTTAAGTTGTCCAG -3'
(R):5'- ACTACTTATGGATCATACCACTTGG -3'
Posted On 2021-04-30