Mutagenetix > Incidental Mutations

Incidental Mutation 'R8798:Xrcc5'

671339

Institutional Source

Beutler Lab

Gene Symbol

Xrcc5

Ensembl Gene

ENSMUSG00000026187

Gene Name

X-ray repair complementing defective repair in Chinese hamster cells 5

Synonyms

Ku86, Ku80

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8798 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72307421-72394952 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72314178 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 115 (M115T)

Ref Sequence

ENSEMBL: ENSMUSP00000027379 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027379]

AlphaFold

P27641

Predicted Effect

probably damaging
Transcript: ENSMUST00000027379
AA Change: M115T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027379
Gene: ENSMUSG00000026187
AA Change: M115T

Domain	Start	End	E-Value	Type
VWA	7	245	8.07e-2	SMART
Ku78	302	441	8.9e-52	SMART
Pfam:Ku_C	476	570	6.9e-23	PFAM
Pfam:Ku_PK_bind	594	707	9.3e-31	PFAM

Meta Mutation Damage Score

0.7172

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants are defective in DNA double-strand break repair and show impaired growth and severe combined immunodeficiency due to defective assembly of TCRs and immunoglobulins. Mutants die early with osteopenia, atrophic skin and hepatic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	G	A	8: 79,210,751	R176*	probably null	Het
2610044O15Rik8	G	A	8: 129,219,298	H349Y	probably damaging	Het
4921539E11Rik	A	C	4: 103,266,377		probably benign	Het
A430078G23Rik	T	A	8: 3,364,645	Y8N	probably benign	Het
Abcc2	A	G	19: 43,808,666	N492S	probably benign	Het
Acox1	T	C	11: 116,174,357	Y624C	probably damaging	Het
Aff4	T	C	11: 53,400,508		probably benign	Het
Ak9	T	A	10: 41,382,851	D781E		Het
Arfgef3	T	C	10: 18,647,051	D409G	probably damaging	Het
Blnk	A	G	19: 40,962,351	Y119H	probably damaging	Het
Brsk2	T	C	7: 141,987,864	L310P	probably damaging	Het
Cit	T	A	5: 115,969,043	L1078Q	probably damaging	Het
Cpn1	A	T	19: 43,986,236	V18D	possibly damaging	Het
Csmd3	A	T	15: 47,731,986	Y1115N		Het
Dnah9	A	C	11: 65,905,231	V3589G	probably damaging	Het
Dpp9	T	C	17: 56,199,037	Y454C	probably damaging	Het
Eif3i	A	G	4: 129,596,924	V67A	probably benign	Het
Eif6	T	C	2: 155,822,966	N200S	probably damaging	Het
Fbxo10	T	C	4: 45,051,605	H502R	possibly damaging	Het
Fcer1a	A	G	1: 173,225,480	Y50H	probably benign	Het
Filip1	G	A	9: 79,820,090	H416Y	possibly damaging	Het
Frmpd1	A	T	4: 45,285,424	N1415I	possibly damaging	Het
Gdpgp1	C	T	7: 80,238,977	P252L	probably damaging	Het
Gm340	C	T	19: 41,585,259	R818W	probably damaging	Het
Gsap	T	C	5: 21,271,250		probably null	Het
Hgs	T	C	11: 120,480,112	V598A	probably benign	Het
Irf2	G	T	8: 46,807,314	V94L	probably benign	Het
Kalrn	G	T	16: 33,982,855	H2675Q	possibly damaging	Het
Klhl33	C	A	14: 50,893,108	A50S	possibly damaging	Het
Klk1b11	T	C	7: 43,995,948	I15T	probably benign	Het
Lrrn3	A	G	12: 41,453,175	M381T	possibly damaging	Het
Ltbr	A	G	6: 125,307,295	Y395H	probably benign	Het
Ltf	A	G	9: 111,023,760		probably benign	Het
Ly75	A	G	2: 60,323,926	F1059S	probably benign	Het
Lypd6	T	A	2: 50,188,762	I90N	possibly damaging	Het
Map1a	G	A	2: 121,302,287	V1195M	probably benign	Het
Mb21d1	G	A	9: 78,443,066	R5C	probably benign	Het
Mroh2b	A	T	15: 4,948,709	I1320F	probably damaging	Het
Mug2	A	G	6: 122,081,610	T1324A	probably damaging	Het
Mylk	G	A	16: 34,899,402	V562M	possibly damaging	Het
Myo15b	G	A	11: 115,863,406	G911R		Het
Neo1	A	G	9: 58,913,166	Y825H	probably damaging	Het
Nfat5	T	G	8: 107,347,689	V343G	probably damaging	Het
Nlrp2	A	T	7: 5,327,888	I503K	possibly damaging	Het
Olfr180	A	T	16: 58,915,944	D232E	probably benign	Het
Olfr270	C	A	4: 52,970,790	H56Q	possibly damaging	Het
Olfr924	G	A	9: 38,848,917	E268K	probably benign	Het
Olfr975	G	A	9: 39,950,717	T18I	probably benign	Het
Pdcl2	T	C	5: 76,325,100	D7G	probably damaging	Het
Phyh	C	T	2: 4,919,082	R5C	probably damaging	Het
Prr11	A	C	11: 87,106,055	S28A	unknown	Het
Psmd13	T	A	7: 140,897,750	L190*	probably null	Het
Ptx4	A	G	17: 25,124,742	D322G	probably damaging	Het
Rnf40	T	C	7: 127,589,782	L109P	probably damaging	Het
Rrp1	T	C	10: 78,409,190	T102A	probably damaging	Het
Sema4a	T	G	3: 88,436,697	D749A	possibly damaging	Het
Serpina3f	A	T	12: 104,217,443	D188V	probably benign	Het
Smarca5	C	A	8: 80,716,508	A570S	probably damaging	Het
Spocd1	G	C	4: 129,930,204		probably null	Het
Stard9	G	A	2: 120,704,731	G3823D	probably benign	Het
Suco	A	G	1: 161,820,435	L1094S	probably damaging	Het
Tcf7	T	C	11: 52,260,594	D79G	probably damaging	Het
Tdrd12	A	G	7: 35,529,180	M39T	probably damaging	Het
Thnsl1	A	G	2: 21,212,398	N321S	probably benign	Het
Tmem132c	T	A	5: 127,360,153	Y235*	probably null	Het
Tnfaip6	T	C	2: 52,043,812	F60L	probably benign	Het
Tnpo3	T	C	6: 29,572,621	I411V	probably benign	Het
Trio	A	C	15: 27,851,837	V856G	possibly damaging	Het
Trpc2	C	G	7: 102,084,560	R239G	probably benign	Het
Ttn	C	T	2: 76,826,132	V12502I	unknown	Het
Usf3	A	G	16: 44,220,173	D1672G	probably damaging	Het
Usp24	A	G	4: 106,379,239	N1011S	probably benign	Het
Vac14	A	G	8: 110,719,887	E756G	probably benign	Het
Vmn2r41	A	G	7: 8,161,523	L10P	probably damaging	Het
Zfp827	G	A	8: 79,189,834		probably benign	Het
Zmym1	A	T	4: 127,049,871	N241K	possibly damaging	Het

Other mutations in Xrcc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01396:Xrcc5	APN	1	72354245	missense	probably benign	0.01
IGL01599:Xrcc5	APN	1	72346349	missense	possibly damaging	0.72
IGL01714:Xrcc5	APN	1	72329984	missense	probably damaging	0.98
IGL02740:Xrcc5	APN	1	72340081	critical splice donor site	probably null
IGL02884:Xrcc5	APN	1	72346237	missense	possibly damaging	0.95
barbarian	UTSW	1	72314178	missense	probably damaging	1.00
durio	UTSW	1	72339029	missense	probably damaging	1.00
Highlander	UTSW	1	72319127	missense	possibly damaging	0.55
R6935_Xrcc5_229	UTSW	1	72343030	missense	possibly damaging	0.82
xenophobe	UTSW	1	72312436	missense	probably damaging	1.00
zibethinus	UTSW	1	72310458	missense	probably damaging	1.00
PIT4362001:Xrcc5	UTSW	1	72393929	missense	probably benign
R0309:Xrcc5	UTSW	1	72307576	unclassified	probably benign
R0485:Xrcc5	UTSW	1	72338945	splice site	probably benign
R1004:Xrcc5	UTSW	1	72383778	splice site	probably benign
R1421:Xrcc5	UTSW	1	72310477	missense	probably benign	0.00
R1530:Xrcc5	UTSW	1	72329944	missense	probably damaging	0.98
R1694:Xrcc5	UTSW	1	72319096	missense	possibly damaging	0.88
R1750:Xrcc5	UTSW	1	72325087	nonsense	probably null
R2037:Xrcc5	UTSW	1	72346370	missense	probably benign	0.01
R2296:Xrcc5	UTSW	1	72346326	missense	probably benign	0.00
R4299:Xrcc5	UTSW	1	72394720	makesense	probably null
R4388:Xrcc5	UTSW	1	72330030	missense	possibly damaging	0.46
R4527:Xrcc5	UTSW	1	72312500	missense	probably damaging	1.00
R4857:Xrcc5	UTSW	1	72326265	missense	possibly damaging	0.92
R5073:Xrcc5	UTSW	1	72339029	missense	probably damaging	1.00
R5233:Xrcc5	UTSW	1	72340050	missense	probably damaging	1.00
R5521:Xrcc5	UTSW	1	72346271	missense	probably damaging	1.00
R5996:Xrcc5	UTSW	1	72310458	missense	probably damaging	1.00
R6583:Xrcc5	UTSW	1	72312593	critical splice donor site	probably null
R6638:Xrcc5	UTSW	1	72383362	missense	possibly damaging	0.94
R6935:Xrcc5	UTSW	1	72343030	missense	possibly damaging	0.82
R7046:Xrcc5	UTSW	1	72394716	missense	probably benign	0.00
R7446:Xrcc5	UTSW	1	72393973	splice site	probably null
R7473:Xrcc5	UTSW	1	72312589	missense	probably damaging	1.00
R7875:Xrcc5	UTSW	1	72329931	missense	probably damaging	1.00
R7889:Xrcc5	UTSW	1	72356826	missense	probably benign	0.45
R8088:Xrcc5	UTSW	1	72312436	missense	probably damaging	1.00
R8179:Xrcc5	UTSW	1	72356857	missense	probably damaging	0.99
R8297:Xrcc5	UTSW	1	72325085	missense	possibly damaging	0.47
R8309:Xrcc5	UTSW	1	72319127	missense	possibly damaging	0.55
R8717:Xrcc5	UTSW	1	72383746	missense	probably benign
R8775:Xrcc5	UTSW	1	72393930	missense	probably benign	0.01
R8775-TAIL:Xrcc5	UTSW	1	72393930	missense	probably benign	0.01
R8889:Xrcc5	UTSW	1	72343031	missense	possibly damaging	0.90
R8892:Xrcc5	UTSW	1	72343031	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TAGAGTCTGGGACACATGGG -3'
(R):5'- GTACAGCACACCAACTACTTATGG -3'

Sequencing Primer
(F):5'- GGCAAGCCCTTTTAAGTTGTCCAG -3'
(R):5'- ACTACTTATGGATCATACCACTTGG -3'

Posted On

2021-04-30