Incidental Mutation 'R8798:Mug2'
ID 671365
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission 068724-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8798 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 121983720-122062924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122058569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1324 (T1324A)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably damaging
Transcript: ENSMUST00000081777
AA Change: T1324A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: T1324A

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik G A 8: 79,937,380 (GRCm39) R176* probably null Het
4921539E11Rik A C 4: 103,123,574 (GRCm39) probably benign Het
Abcc2 A G 19: 43,797,105 (GRCm39) N492S probably benign Het
Acox1 T C 11: 116,065,183 (GRCm39) Y624C probably damaging Het
Aff4 T C 11: 53,291,335 (GRCm39) probably benign Het
Ak9 T A 10: 41,258,847 (GRCm39) D781E Het
Arfgef3 T C 10: 18,522,799 (GRCm39) D409G probably damaging Het
Arhgef18 T A 8: 3,414,645 (GRCm39) Y8N probably benign Het
Blnk A G 19: 40,950,795 (GRCm39) Y119H probably damaging Het
Brsk2 T C 7: 141,541,601 (GRCm39) L310P probably damaging Het
Cgas G A 9: 78,350,348 (GRCm39) R5C probably benign Het
Cit T A 5: 116,107,102 (GRCm39) L1078Q probably damaging Het
Cpn1 A T 19: 43,974,675 (GRCm39) V18D possibly damaging Het
Csmd3 A T 15: 47,595,382 (GRCm39) Y1115N Het
Dnah9 A C 11: 65,796,057 (GRCm39) V3589G probably damaging Het
Dpp9 T C 17: 56,506,037 (GRCm39) Y454C probably damaging Het
Eif3i A G 4: 129,490,717 (GRCm39) V67A probably benign Het
Eif6 T C 2: 155,664,886 (GRCm39) N200S probably damaging Het
Fbxo10 T C 4: 45,051,605 (GRCm39) H502R possibly damaging Het
Fcer1a A G 1: 173,053,047 (GRCm39) Y50H probably benign Het
Filip1 G A 9: 79,727,372 (GRCm39) H416Y possibly damaging Het
Frmpd1 A T 4: 45,285,424 (GRCm39) N1415I possibly damaging Het
Gdpgp1 C T 7: 79,888,725 (GRCm39) P252L probably damaging Het
Gsap T C 5: 21,476,248 (GRCm39) probably null Het
Hgs T C 11: 120,370,938 (GRCm39) V598A probably benign Het
Irf2 G T 8: 47,260,349 (GRCm39) V94L probably benign Het
Kalrn G T 16: 33,803,225 (GRCm39) H2675Q possibly damaging Het
Klhl33 C A 14: 51,130,565 (GRCm39) A50S possibly damaging Het
Klk1b11 T C 7: 43,645,372 (GRCm39) I15T probably benign Het
Lcor C T 19: 41,573,698 (GRCm39) R818W probably damaging Het
Lrrn3 A G 12: 41,503,174 (GRCm39) M381T possibly damaging Het
Ltbr A G 6: 125,284,258 (GRCm39) Y395H probably benign Het
Ltf A G 9: 110,852,828 (GRCm39) probably benign Het
Ly75 A G 2: 60,154,270 (GRCm39) F1059S probably benign Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Map1a G A 2: 121,132,768 (GRCm39) V1195M probably benign Het
Mroh2b A T 15: 4,978,191 (GRCm39) I1320F probably damaging Het
Mylk G A 16: 34,719,772 (GRCm39) V562M possibly damaging Het
Myo15b G A 11: 115,754,232 (GRCm39) G911R Het
Neo1 A G 9: 58,820,449 (GRCm39) Y825H probably damaging Het
Nfat5 T G 8: 108,074,321 (GRCm39) V343G probably damaging Het
Nlrp2 A T 7: 5,330,887 (GRCm39) I503K possibly damaging Het
Or10d5 G A 9: 39,862,013 (GRCm39) T18I probably benign Het
Or13d1 C A 4: 52,970,790 (GRCm39) H56Q possibly damaging Het
Or5k16 A T 16: 58,736,307 (GRCm39) D232E probably benign Het
Or8d2 G A 9: 38,760,213 (GRCm39) E268K probably benign Het
Pdcl2 T C 5: 76,472,947 (GRCm39) D7G probably damaging Het
Phyh C T 2: 4,923,893 (GRCm39) R5C probably damaging Het
Prr11 A C 11: 86,996,881 (GRCm39) S28A unknown Het
Psmd13 T A 7: 140,477,663 (GRCm39) L190* probably null Het
Ptx4 A G 17: 25,343,716 (GRCm39) D322G probably damaging Het
Rnf40 T C 7: 127,188,954 (GRCm39) L109P probably damaging Het
Rrp1 T C 10: 78,245,024 (GRCm39) T102A probably damaging Het
Sema4a T G 3: 88,344,004 (GRCm39) D749A possibly damaging Het
Serpina3f A T 12: 104,183,702 (GRCm39) D188V probably benign Het
Smarca5 C A 8: 81,443,137 (GRCm39) A570S probably damaging Het
Spocd1 G C 4: 129,823,997 (GRCm39) probably null Het
Stard9 G A 2: 120,535,212 (GRCm39) G3823D probably benign Het
Suco A G 1: 161,648,004 (GRCm39) L1094S probably damaging Het
Tcf7 T C 11: 52,151,421 (GRCm39) D79G probably damaging Het
Tdrd12 A G 7: 35,228,605 (GRCm39) M39T probably damaging Het
Thnsl1 A G 2: 21,217,209 (GRCm39) N321S probably benign Het
Tmem132c T A 5: 127,437,217 (GRCm39) Y235* probably null Het
Tnfaip6 T C 2: 51,933,824 (GRCm39) F60L probably benign Het
Tnpo3 T C 6: 29,572,620 (GRCm39) I411V probably benign Het
Trio A C 15: 27,851,923 (GRCm39) V856G possibly damaging Het
Trpc2 C G 7: 101,733,767 (GRCm39) R239G probably benign Het
Ttn C T 2: 76,656,476 (GRCm39) V12502I unknown Het
Usf3 A G 16: 44,040,536 (GRCm39) D1672G probably damaging Het
Usp24 A G 4: 106,236,436 (GRCm39) N1011S probably benign Het
Vac14 A G 8: 111,446,519 (GRCm39) E756G probably benign Het
Vmn2r41 A G 7: 8,164,522 (GRCm39) L10P probably damaging Het
Xrcc5 T C 1: 72,353,337 (GRCm39) M115T probably damaging Het
Zfp1006 G A 8: 129,945,779 (GRCm39) H349Y probably damaging Het
Zfp827 G A 8: 79,916,463 (GRCm39) probably benign Het
Zmym1 A T 4: 126,943,664 (GRCm39) N241K possibly damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122,024,446 (GRCm39) missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122,017,613 (GRCm39) missense probably damaging 0.99
IGL01314:Mug2 APN 6 122,058,238 (GRCm39) missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122,026,587 (GRCm39) splice site probably benign
IGL01477:Mug2 APN 6 122,058,643 (GRCm39) splice site probably benign
IGL01926:Mug2 APN 6 122,013,063 (GRCm39) splice site probably benign
IGL02019:Mug2 APN 6 122,024,394 (GRCm39) missense probably benign 0.02
IGL02305:Mug2 APN 6 122,013,015 (GRCm39) missense probably benign
IGL02310:Mug2 APN 6 122,036,082 (GRCm39) splice site probably benign
IGL02484:Mug2 APN 6 122,049,712 (GRCm39) missense probably damaging 1.00
IGL02516:Mug2 APN 6 122,047,802 (GRCm39) missense probably damaging 1.00
IGL02531:Mug2 APN 6 122,049,730 (GRCm39) missense probably damaging 1.00
IGL02666:Mug2 APN 6 122,058,285 (GRCm39) missense probably damaging 1.00
IGL02936:Mug2 APN 6 122,058,346 (GRCm39) critical splice donor site probably null
R0114:Mug2 UTSW 6 122,017,607 (GRCm39) missense probably damaging 1.00
R0119:Mug2 UTSW 6 122,013,022 (GRCm39) missense probably benign 0.00
R0123:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122,047,970 (GRCm39) splice site probably benign
R0225:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122,058,558 (GRCm39) missense probably damaging 1.00
R0763:Mug2 UTSW 6 122,052,253 (GRCm39) missense probably benign
R0959:Mug2 UTSW 6 122,062,454 (GRCm39) missense probably benign 0.33
R1104:Mug2 UTSW 6 122,036,014 (GRCm39) missense probably benign
R1239:Mug2 UTSW 6 122,058,637 (GRCm39) splice site probably benign
R1318:Mug2 UTSW 6 122,054,361 (GRCm39) missense probably damaging 1.00
R1460:Mug2 UTSW 6 122,017,492 (GRCm39) splice site probably benign
R1706:Mug2 UTSW 6 122,013,191 (GRCm39) splice site probably benign
R1761:Mug2 UTSW 6 122,051,664 (GRCm39) missense probably benign 0.20
R1901:Mug2 UTSW 6 122,048,801 (GRCm39) missense probably benign 0.02
R1913:Mug2 UTSW 6 122,047,829 (GRCm39) missense probably damaging 1.00
R1943:Mug2 UTSW 6 122,056,598 (GRCm39) missense probably benign
R2054:Mug2 UTSW 6 122,054,451 (GRCm39) missense probably damaging 1.00
R2060:Mug2 UTSW 6 122,056,571 (GRCm39) missense probably benign
R2420:Mug2 UTSW 6 122,060,419 (GRCm39) missense probably damaging 1.00
R2432:Mug2 UTSW 6 122,061,335 (GRCm39) missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R2918:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R3423:Mug2 UTSW 6 122,024,465 (GRCm39) splice site probably benign
R3834:Mug2 UTSW 6 122,026,746 (GRCm39) critical splice donor site probably null
R3902:Mug2 UTSW 6 122,052,526 (GRCm39) missense probably damaging 1.00
R3941:Mug2 UTSW 6 122,040,522 (GRCm39) missense probably benign
R4227:Mug2 UTSW 6 122,017,691 (GRCm39) missense probably benign 0.10
R4284:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4287:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4377:Mug2 UTSW 6 122,047,966 (GRCm39) critical splice donor site probably null
R4419:Mug2 UTSW 6 122,056,589 (GRCm39) missense probably damaging 1.00
R4498:Mug2 UTSW 6 122,059,711 (GRCm39) missense probably damaging 0.99
R4566:Mug2 UTSW 6 122,056,597 (GRCm39) missense probably benign 0.00
R4690:Mug2 UTSW 6 122,013,255 (GRCm39) missense probably benign
R4732:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4733:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4741:Mug2 UTSW 6 122,056,572 (GRCm39) missense probably benign
R4888:Mug2 UTSW 6 122,058,154 (GRCm39) missense probably damaging 1.00
R5199:Mug2 UTSW 6 122,017,619 (GRCm39) missense probably benign
R5347:Mug2 UTSW 6 122,058,551 (GRCm39) missense probably damaging 1.00
R5457:Mug2 UTSW 6 122,026,688 (GRCm39) nonsense probably null
R5495:Mug2 UTSW 6 122,056,609 (GRCm39) missense probably damaging 0.96
R5509:Mug2 UTSW 6 122,061,340 (GRCm39) missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122,060,459 (GRCm39) missense probably null 0.98
R6180:Mug2 UTSW 6 122,056,565 (GRCm39) missense probably benign 0.01
R6184:Mug2 UTSW 6 122,014,005 (GRCm39) missense probably benign
R6199:Mug2 UTSW 6 122,024,398 (GRCm39) missense probably benign 0.05
R6262:Mug2 UTSW 6 122,052,214 (GRCm39) missense probably damaging 1.00
R6416:Mug2 UTSW 6 122,059,713 (GRCm39) missense probably damaging 1.00
R6548:Mug2 UTSW 6 122,024,401 (GRCm39) missense probably damaging 1.00
R6703:Mug2 UTSW 6 122,055,653 (GRCm39) missense probably benign 0.25
R7106:Mug2 UTSW 6 122,059,680 (GRCm39) missense probably damaging 1.00
R7131:Mug2 UTSW 6 122,052,206 (GRCm39) missense probably damaging 1.00
R7372:Mug2 UTSW 6 122,060,425 (GRCm39) missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122,024,446 (GRCm39) missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122,017,529 (GRCm39) missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122,056,685 (GRCm39) missense probably benign 0.00
R7581:Mug2 UTSW 6 122,040,670 (GRCm39) missense probably damaging 1.00
R7582:Mug2 UTSW 6 122,056,603 (GRCm39) missense probably damaging 0.99
R7672:Mug2 UTSW 6 122,017,678 (GRCm39) missense probably benign 0.37
R7713:Mug2 UTSW 6 122,055,754 (GRCm39) missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122,058,317 (GRCm39) missense probably damaging 1.00
R7834:Mug2 UTSW 6 122,013,241 (GRCm39) missense probably benign
R7850:Mug2 UTSW 6 122,052,170 (GRCm39) missense probably damaging 1.00
R8029:Mug2 UTSW 6 122,058,504 (GRCm39) critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122,052,567 (GRCm39) missense probably benign 0.01
R8335:Mug2 UTSW 6 122,017,543 (GRCm39) missense probably benign
R8348:Mug2 UTSW 6 122,049,192 (GRCm39) nonsense probably null
R8557:Mug2 UTSW 6 122,040,660 (GRCm39) missense probably damaging 0.99
R8823:Mug2 UTSW 6 122,040,648 (GRCm39) missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122,061,328 (GRCm39) missense probably damaging 1.00
R9153:Mug2 UTSW 6 122,017,627 (GRCm39) missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122,054,442 (GRCm39) missense probably benign 0.06
R9186:Mug2 UTSW 6 122,052,248 (GRCm39) missense probably damaging 0.99
R9418:Mug2 UTSW 6 122,017,700 (GRCm39) missense probably benign 0.00
R9464:Mug2 UTSW 6 122,028,690 (GRCm39) missense probably benign 0.01
R9622:Mug2 UTSW 6 122,028,751 (GRCm39) missense probably benign 0.29
Z1177:Mug2 UTSW 6 122,014,080 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCAAAATGGAAAGTCTGAC -3'
(R):5'- GAGTTCTAGGAAGACAGCCTGATAG -3'

Sequencing Primer
(F):5'- AAAGTCTGACTTTGCCTACCTG -3'
(R):5'- CAGCCTGATAGTAGCTGAGGGAC -3'
Posted On 2021-04-30