Incidental Mutation 'R8798:Gdpgp1'
ID 671371
Institutional Source Beutler Lab
Gene Symbol Gdpgp1
Ensembl Gene ENSMUSG00000050973
Gene Name GDP-D-glucose phosphorylase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R8798 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80232865-80242061 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80238977 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 252 (P252L)
Ref Sequence ENSEMBL: ENSMUSP00000061808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062915]
AlphaFold Q3TLS3
Predicted Effect probably damaging
Transcript: ENSMUST00000062915
AA Change: P252L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061808
Gene: ENSMUSG00000050973
AA Change: P252L

DomainStartEndE-ValueType
SCOP:d1kpf__ 150 223 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik G A 8: 79,210,751 R176* probably null Het
2610044O15Rik8 G A 8: 129,219,298 H349Y probably damaging Het
4921539E11Rik A C 4: 103,266,377 probably benign Het
A430078G23Rik T A 8: 3,364,645 Y8N probably benign Het
Abcc2 A G 19: 43,808,666 N492S probably benign Het
Acox1 T C 11: 116,174,357 Y624C probably damaging Het
Aff4 T C 11: 53,400,508 probably benign Het
Ak9 T A 10: 41,382,851 D781E Het
Arfgef3 T C 10: 18,647,051 D409G probably damaging Het
Blnk A G 19: 40,962,351 Y119H probably damaging Het
Brsk2 T C 7: 141,987,864 L310P probably damaging Het
Cit T A 5: 115,969,043 L1078Q probably damaging Het
Cpn1 A T 19: 43,986,236 V18D possibly damaging Het
Csmd3 A T 15: 47,731,986 Y1115N Het
Dnah9 A C 11: 65,905,231 V3589G probably damaging Het
Dpp9 T C 17: 56,199,037 Y454C probably damaging Het
Eif3i A G 4: 129,596,924 V67A probably benign Het
Eif6 T C 2: 155,822,966 N200S probably damaging Het
Fbxo10 T C 4: 45,051,605 H502R possibly damaging Het
Fcer1a A G 1: 173,225,480 Y50H probably benign Het
Filip1 G A 9: 79,820,090 H416Y possibly damaging Het
Frmpd1 A T 4: 45,285,424 N1415I possibly damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gsap T C 5: 21,271,250 probably null Het
Hgs T C 11: 120,480,112 V598A probably benign Het
Irf2 G T 8: 46,807,314 V94L probably benign Het
Kalrn G T 16: 33,982,855 H2675Q possibly damaging Het
Klhl33 C A 14: 50,893,108 A50S possibly damaging Het
Klk1b11 T C 7: 43,995,948 I15T probably benign Het
Lrrn3 A G 12: 41,453,175 M381T possibly damaging Het
Ltbr A G 6: 125,307,295 Y395H probably benign Het
Ltf A G 9: 111,023,760 probably benign Het
Ly75 A G 2: 60,323,926 F1059S probably benign Het
Lypd6 T A 2: 50,188,762 I90N possibly damaging Het
Map1a G A 2: 121,302,287 V1195M probably benign Het
Mb21d1 G A 9: 78,443,066 R5C probably benign Het
Mroh2b A T 15: 4,948,709 I1320F probably damaging Het
Mug2 A G 6: 122,081,610 T1324A probably damaging Het
Mylk G A 16: 34,899,402 V562M possibly damaging Het
Myo15b G A 11: 115,863,406 G911R Het
Neo1 A G 9: 58,913,166 Y825H probably damaging Het
Nfat5 T G 8: 107,347,689 V343G probably damaging Het
Nlrp2 A T 7: 5,327,888 I503K possibly damaging Het
Olfr180 A T 16: 58,915,944 D232E probably benign Het
Olfr270 C A 4: 52,970,790 H56Q possibly damaging Het
Olfr924 G A 9: 38,848,917 E268K probably benign Het
Olfr975 G A 9: 39,950,717 T18I probably benign Het
Pdcl2 T C 5: 76,325,100 D7G probably damaging Het
Phyh C T 2: 4,919,082 R5C probably damaging Het
Prr11 A C 11: 87,106,055 S28A unknown Het
Psmd13 T A 7: 140,897,750 L190* probably null Het
Ptx4 A G 17: 25,124,742 D322G probably damaging Het
Rnf40 T C 7: 127,589,782 L109P probably damaging Het
Rrp1 T C 10: 78,409,190 T102A probably damaging Het
Sema4a T G 3: 88,436,697 D749A possibly damaging Het
Serpina3f A T 12: 104,217,443 D188V probably benign Het
Smarca5 C A 8: 80,716,508 A570S probably damaging Het
Spocd1 G C 4: 129,930,204 probably null Het
Stard9 G A 2: 120,704,731 G3823D probably benign Het
Suco A G 1: 161,820,435 L1094S probably damaging Het
Tcf7 T C 11: 52,260,594 D79G probably damaging Het
Tdrd12 A G 7: 35,529,180 M39T probably damaging Het
Thnsl1 A G 2: 21,212,398 N321S probably benign Het
Tmem132c T A 5: 127,360,153 Y235* probably null Het
Tnfaip6 T C 2: 52,043,812 F60L probably benign Het
Tnpo3 T C 6: 29,572,621 I411V probably benign Het
Trio A C 15: 27,851,837 V856G possibly damaging Het
Trpc2 C G 7: 102,084,560 R239G probably benign Het
Ttn C T 2: 76,826,132 V12502I unknown Het
Usf3 A G 16: 44,220,173 D1672G probably damaging Het
Usp24 A G 4: 106,379,239 N1011S probably benign Het
Vac14 A G 8: 110,719,887 E756G probably benign Het
Vmn2r41 A G 7: 8,161,523 L10P probably damaging Het
Xrcc5 T C 1: 72,314,178 M115T probably damaging Het
Zfp827 G A 8: 79,189,834 probably benign Het
Zmym1 A T 4: 127,049,871 N241K possibly damaging Het
Other mutations in Gdpgp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Gdpgp1 APN 7 80239352 missense probably damaging 1.00
IGL02079:Gdpgp1 APN 7 80239020 missense probably benign 0.01
IGL02641:Gdpgp1 APN 7 80239048 nonsense probably null
IGL03209:Gdpgp1 APN 7 80239099 missense probably damaging 1.00
IGL03356:Gdpgp1 APN 7 80238695 missense possibly damaging 0.89
R1158:Gdpgp1 UTSW 7 80238502 missense probably benign 0.01
R1652:Gdpgp1 UTSW 7 80239364 missense probably benign 0.20
R1851:Gdpgp1 UTSW 7 80238601 missense probably damaging 0.97
R1872:Gdpgp1 UTSW 7 80238424 missense probably benign 0.00
R6119:Gdpgp1 UTSW 7 80238992 missense probably damaging 1.00
R6318:Gdpgp1 UTSW 7 80239150 missense possibly damaging 0.89
R7679:Gdpgp1 UTSW 7 80238576 missense probably benign 0.30
R7936:Gdpgp1 UTSW 7 80239078 missense probably damaging 0.98
R7940:Gdpgp1 UTSW 7 80239205 missense probably damaging 1.00
R8109:Gdpgp1 UTSW 7 80238833 missense probably damaging 1.00
R8882:Gdpgp1 UTSW 7 80238956 missense possibly damaging 0.50
R9094:Gdpgp1 UTSW 7 80238468 missense probably benign 0.00
R9100:Gdpgp1 UTSW 7 80238534 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCTGTCCTACTGAGCTTGC -3'
(R):5'- CAGAGGGCAACATTAAACGC -3'

Sequencing Primer
(F):5'- TACTGAGCTTGCACCCAGG -3'
(R):5'- GAATGACTCGGATCCCACTGAG -3'
Posted On 2021-04-30