Incidental Mutation 'R8798:Filip1'
ID 671388
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Name filamin A interacting protein 1
Synonyms FILIP, 5730485H21Rik
MMRRC Submission 068724-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.499) question?
Stock # R8798 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 79712376-79920133 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79727372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 416 (H416Y)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000093811
AA Change: H416Y

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: H416Y

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Meta Mutation Damage Score 0.1297 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik G A 8: 79,937,380 (GRCm39) R176* probably null Het
4921539E11Rik A C 4: 103,123,574 (GRCm39) probably benign Het
Abcc2 A G 19: 43,797,105 (GRCm39) N492S probably benign Het
Acox1 T C 11: 116,065,183 (GRCm39) Y624C probably damaging Het
Aff4 T C 11: 53,291,335 (GRCm39) probably benign Het
Ak9 T A 10: 41,258,847 (GRCm39) D781E Het
Arfgef3 T C 10: 18,522,799 (GRCm39) D409G probably damaging Het
Arhgef18 T A 8: 3,414,645 (GRCm39) Y8N probably benign Het
Blnk A G 19: 40,950,795 (GRCm39) Y119H probably damaging Het
Brsk2 T C 7: 141,541,601 (GRCm39) L310P probably damaging Het
Cgas G A 9: 78,350,348 (GRCm39) R5C probably benign Het
Cit T A 5: 116,107,102 (GRCm39) L1078Q probably damaging Het
Cpn1 A T 19: 43,974,675 (GRCm39) V18D possibly damaging Het
Csmd3 A T 15: 47,595,382 (GRCm39) Y1115N Het
Dnah9 A C 11: 65,796,057 (GRCm39) V3589G probably damaging Het
Dpp9 T C 17: 56,506,037 (GRCm39) Y454C probably damaging Het
Eif3i A G 4: 129,490,717 (GRCm39) V67A probably benign Het
Eif6 T C 2: 155,664,886 (GRCm39) N200S probably damaging Het
Fbxo10 T C 4: 45,051,605 (GRCm39) H502R possibly damaging Het
Fcer1a A G 1: 173,053,047 (GRCm39) Y50H probably benign Het
Frmpd1 A T 4: 45,285,424 (GRCm39) N1415I possibly damaging Het
Gdpgp1 C T 7: 79,888,725 (GRCm39) P252L probably damaging Het
Gsap T C 5: 21,476,248 (GRCm39) probably null Het
Hgs T C 11: 120,370,938 (GRCm39) V598A probably benign Het
Irf2 G T 8: 47,260,349 (GRCm39) V94L probably benign Het
Kalrn G T 16: 33,803,225 (GRCm39) H2675Q possibly damaging Het
Klhl33 C A 14: 51,130,565 (GRCm39) A50S possibly damaging Het
Klk1b11 T C 7: 43,645,372 (GRCm39) I15T probably benign Het
Lcor C T 19: 41,573,698 (GRCm39) R818W probably damaging Het
Lrrn3 A G 12: 41,503,174 (GRCm39) M381T possibly damaging Het
Ltbr A G 6: 125,284,258 (GRCm39) Y395H probably benign Het
Ltf A G 9: 110,852,828 (GRCm39) probably benign Het
Ly75 A G 2: 60,154,270 (GRCm39) F1059S probably benign Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Map1a G A 2: 121,132,768 (GRCm39) V1195M probably benign Het
Mroh2b A T 15: 4,978,191 (GRCm39) I1320F probably damaging Het
Mug2 A G 6: 122,058,569 (GRCm39) T1324A probably damaging Het
Mylk G A 16: 34,719,772 (GRCm39) V562M possibly damaging Het
Myo15b G A 11: 115,754,232 (GRCm39) G911R Het
Neo1 A G 9: 58,820,449 (GRCm39) Y825H probably damaging Het
Nfat5 T G 8: 108,074,321 (GRCm39) V343G probably damaging Het
Nlrp2 A T 7: 5,330,887 (GRCm39) I503K possibly damaging Het
Or10d5 G A 9: 39,862,013 (GRCm39) T18I probably benign Het
Or13d1 C A 4: 52,970,790 (GRCm39) H56Q possibly damaging Het
Or5k16 A T 16: 58,736,307 (GRCm39) D232E probably benign Het
Or8d2 G A 9: 38,760,213 (GRCm39) E268K probably benign Het
Pdcl2 T C 5: 76,472,947 (GRCm39) D7G probably damaging Het
Phyh C T 2: 4,923,893 (GRCm39) R5C probably damaging Het
Prr11 A C 11: 86,996,881 (GRCm39) S28A unknown Het
Psmd13 T A 7: 140,477,663 (GRCm39) L190* probably null Het
Ptx4 A G 17: 25,343,716 (GRCm39) D322G probably damaging Het
Rnf40 T C 7: 127,188,954 (GRCm39) L109P probably damaging Het
Rrp1 T C 10: 78,245,024 (GRCm39) T102A probably damaging Het
Sema4a T G 3: 88,344,004 (GRCm39) D749A possibly damaging Het
Serpina3f A T 12: 104,183,702 (GRCm39) D188V probably benign Het
Smarca5 C A 8: 81,443,137 (GRCm39) A570S probably damaging Het
Spocd1 G C 4: 129,823,997 (GRCm39) probably null Het
Stard9 G A 2: 120,535,212 (GRCm39) G3823D probably benign Het
Suco A G 1: 161,648,004 (GRCm39) L1094S probably damaging Het
Tcf7 T C 11: 52,151,421 (GRCm39) D79G probably damaging Het
Tdrd12 A G 7: 35,228,605 (GRCm39) M39T probably damaging Het
Thnsl1 A G 2: 21,217,209 (GRCm39) N321S probably benign Het
Tmem132c T A 5: 127,437,217 (GRCm39) Y235* probably null Het
Tnfaip6 T C 2: 51,933,824 (GRCm39) F60L probably benign Het
Tnpo3 T C 6: 29,572,620 (GRCm39) I411V probably benign Het
Trio A C 15: 27,851,923 (GRCm39) V856G possibly damaging Het
Trpc2 C G 7: 101,733,767 (GRCm39) R239G probably benign Het
Ttn C T 2: 76,656,476 (GRCm39) V12502I unknown Het
Usf3 A G 16: 44,040,536 (GRCm39) D1672G probably damaging Het
Usp24 A G 4: 106,236,436 (GRCm39) N1011S probably benign Het
Vac14 A G 8: 111,446,519 (GRCm39) E756G probably benign Het
Vmn2r41 A G 7: 8,164,522 (GRCm39) L10P probably damaging Het
Xrcc5 T C 1: 72,353,337 (GRCm39) M115T probably damaging Het
Zfp1006 G A 8: 129,945,779 (GRCm39) H349Y probably damaging Het
Zfp827 G A 8: 79,916,463 (GRCm39) probably benign Het
Zmym1 A T 4: 126,943,664 (GRCm39) N241K possibly damaging Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79,725,226 (GRCm39) missense probably damaging 1.00
IGL01101:Filip1 APN 9 79,805,528 (GRCm39) missense probably benign 0.44
IGL01301:Filip1 APN 9 79,726,462 (GRCm39) missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79,726,899 (GRCm39) missense probably benign 0.42
IGL02119:Filip1 APN 9 79,725,548 (GRCm39) missense probably benign
IGL02285:Filip1 APN 9 79,727,408 (GRCm39) missense probably damaging 1.00
IGL02395:Filip1 APN 9 79,805,692 (GRCm39) missense probably benign 0.01
IGL03398:Filip1 APN 9 79,726,225 (GRCm39) missense probably benign 0.03
IGL03400:Filip1 APN 9 79,727,755 (GRCm39) missense probably benign 0.01
IGL03404:Filip1 APN 9 79,725,841 (GRCm39) missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79,726,462 (GRCm39) missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79,726,810 (GRCm39) missense probably benign 0.04
R0243:Filip1 UTSW 9 79,726,285 (GRCm39) missense probably damaging 0.98
R0244:Filip1 UTSW 9 79,726,744 (GRCm39) missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79,767,373 (GRCm39) missense probably damaging 1.00
R0399:Filip1 UTSW 9 79,725,592 (GRCm39) missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79,727,571 (GRCm39) missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79,726,672 (GRCm39) missense probably damaging 1.00
R1314:Filip1 UTSW 9 79,727,848 (GRCm39) missense probably damaging 1.00
R1465:Filip1 UTSW 9 79,805,589 (GRCm39) missense probably benign 0.25
R1465:Filip1 UTSW 9 79,805,589 (GRCm39) missense probably benign 0.25
R1602:Filip1 UTSW 9 79,727,873 (GRCm39) missense probably damaging 0.99
R1801:Filip1 UTSW 9 79,723,128 (GRCm39) missense probably damaging 0.98
R1929:Filip1 UTSW 9 79,727,212 (GRCm39) missense probably damaging 1.00
R1983:Filip1 UTSW 9 79,767,374 (GRCm39) missense probably damaging 1.00
R2066:Filip1 UTSW 9 79,727,498 (GRCm39) missense probably damaging 1.00
R2128:Filip1 UTSW 9 79,726,612 (GRCm39) missense probably damaging 0.99
R2271:Filip1 UTSW 9 79,727,212 (GRCm39) missense probably damaging 1.00
R2411:Filip1 UTSW 9 79,805,715 (GRCm39) missense probably damaging 0.98
R3429:Filip1 UTSW 9 79,760,952 (GRCm39) missense probably damaging 1.00
R3430:Filip1 UTSW 9 79,760,952 (GRCm39) missense probably damaging 1.00
R3945:Filip1 UTSW 9 79,725,649 (GRCm39) missense probably benign 0.01
R4007:Filip1 UTSW 9 79,726,009 (GRCm39) missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79,723,091 (GRCm39) missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79,727,396 (GRCm39) missense probably benign 0.05
R4837:Filip1 UTSW 9 79,726,741 (GRCm39) missense probably damaging 0.98
R4910:Filip1 UTSW 9 79,725,214 (GRCm39) missense probably benign 0.00
R4929:Filip1 UTSW 9 79,727,029 (GRCm39) missense probably benign 0.07
R5387:Filip1 UTSW 9 79,725,556 (GRCm39) missense probably benign
R5581:Filip1 UTSW 9 79,727,042 (GRCm39) missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79,725,983 (GRCm39) missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79,727,142 (GRCm39) missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79,726,736 (GRCm39) missense probably damaging 0.99
R6273:Filip1 UTSW 9 79,723,168 (GRCm39) missense probably benign 0.01
R6380:Filip1 UTSW 9 79,726,906 (GRCm39) missense probably damaging 0.99
R6385:Filip1 UTSW 9 79,727,813 (GRCm39) missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79,723,121 (GRCm39) missense probably damaging 1.00
R6715:Filip1 UTSW 9 79,726,040 (GRCm39) missense probably benign 0.03
R7047:Filip1 UTSW 9 79,760,916 (GRCm39) missense probably damaging 0.98
R7126:Filip1 UTSW 9 79,805,577 (GRCm39) missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79,727,495 (GRCm39) missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79,725,356 (GRCm39) missense probably benign
R7404:Filip1 UTSW 9 79,727,380 (GRCm39) missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79,727,931 (GRCm39) missense probably benign 0.20
R7866:Filip1 UTSW 9 79,726,225 (GRCm39) missense probably benign 0.03
R7933:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79,725,241 (GRCm39) missense probably damaging 0.97
R8097:Filip1 UTSW 9 79,725,541 (GRCm39) missense probably benign
R8213:Filip1 UTSW 9 79,725,374 (GRCm39) missense probably benign 0.01
R8305:Filip1 UTSW 9 79,727,757 (GRCm39) nonsense probably null
R9184:Filip1 UTSW 9 79,805,542 (GRCm39) missense probably benign 0.03
R9322:Filip1 UTSW 9 79,727,014 (GRCm39) missense probably benign 0.01
R9334:Filip1 UTSW 9 79,725,739 (GRCm39) missense probably benign 0.32
R9353:Filip1 UTSW 9 79,725,623 (GRCm39) missense possibly damaging 0.67
R9541:Filip1 UTSW 9 79,727,135 (GRCm39) nonsense probably null
R9607:Filip1 UTSW 9 79,726,402 (GRCm39) missense probably damaging 1.00
X0054:Filip1 UTSW 9 79,726,817 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTAACCCGACTCTTGACCAC -3'
(R):5'- TTGGCTTATCGCAAAGGATCG -3'

Sequencing Primer
(F):5'- GACCACCTCCAGCTCGTTCAG -3'
(R):5'- CTTATCGCAAAGGATCGAGGAACTG -3'
Posted On 2021-04-30