Mutagenetix > Incidental Mutation

Incidental Mutation 'R8798:Filip1'

671388

Institutional Source

Beutler Lab

Gene Symbol

Filip1

Ensembl Gene

ENSMUSG00000034898

Gene Name

filamin A interacting protein 1

Synonyms

5730485H21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.548) question?

Stock #

R8798 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79815051-80012851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 79820090 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 416 (H416Y)

Ref Sequence

ENSEMBL: ENSMUSP00000091329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093811
AA Change: H416Y

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: H416Y

Domain	Start	End	E-Value	Type
Pfam:CortBP2	71	256	2.1e-64	PFAM
coiled coil region	258	540	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	579	592	N/A	INTRINSIC
coiled coil region	625	778	N/A	INTRINSIC
low complexity region	928	940	N/A	INTRINSIC
low complexity region	1126	1140	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1198	1214	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172973

SMART Domains

Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

Domain	Start	End	E-Value	Type
Pfam:CortBP2	65	225	5.2e-74	PFAM

Meta Mutation Damage Score

0.1297

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	G	A	8: 79,210,751	R176*	probably null	Het
2610044O15Rik8	G	A	8: 129,219,298	H349Y	probably damaging	Het
4921539E11Rik	A	C	4: 103,266,377		probably benign	Het
A430078G23Rik	T	A	8: 3,364,645	Y8N	probably benign	Het
Abcc2	A	G	19: 43,808,666	N492S	probably benign	Het
Acox1	T	C	11: 116,174,357	Y624C	probably damaging	Het
Aff4	T	C	11: 53,400,508		probably benign	Het
Ak9	T	A	10: 41,382,851	D781E		Het
Arfgef3	T	C	10: 18,647,051	D409G	probably damaging	Het
Blnk	A	G	19: 40,962,351	Y119H	probably damaging	Het
Brsk2	T	C	7: 141,987,864	L310P	probably damaging	Het
Cit	T	A	5: 115,969,043	L1078Q	probably damaging	Het
Cpn1	A	T	19: 43,986,236	V18D	possibly damaging	Het
Csmd3	A	T	15: 47,731,986	Y1115N		Het
Dnah9	A	C	11: 65,905,231	V3589G	probably damaging	Het
Dpp9	T	C	17: 56,199,037	Y454C	probably damaging	Het
Eif3i	A	G	4: 129,596,924	V67A	probably benign	Het
Eif6	T	C	2: 155,822,966	N200S	probably damaging	Het
Fbxo10	T	C	4: 45,051,605	H502R	possibly damaging	Het
Fcer1a	A	G	1: 173,225,480	Y50H	probably benign	Het
Frmpd1	A	T	4: 45,285,424	N1415I	possibly damaging	Het
Gdpgp1	C	T	7: 80,238,977	P252L	probably damaging	Het
Gm340	C	T	19: 41,585,259	R818W	probably damaging	Het
Gsap	T	C	5: 21,271,250		probably null	Het
Hgs	T	C	11: 120,480,112	V598A	probably benign	Het
Irf2	G	T	8: 46,807,314	V94L	probably benign	Het
Kalrn	G	T	16: 33,982,855	H2675Q	possibly damaging	Het
Klhl33	C	A	14: 50,893,108	A50S	possibly damaging	Het
Klk1b11	T	C	7: 43,995,948	I15T	probably benign	Het
Lrrn3	A	G	12: 41,453,175	M381T	possibly damaging	Het
Ltbr	A	G	6: 125,307,295	Y395H	probably benign	Het
Ltf	A	G	9: 111,023,760		probably benign	Het
Ly75	A	G	2: 60,323,926	F1059S	probably benign	Het
Lypd6	T	A	2: 50,188,762	I90N	possibly damaging	Het
Map1a	G	A	2: 121,302,287	V1195M	probably benign	Het
Mb21d1	G	A	9: 78,443,066	R5C	probably benign	Het
Mroh2b	A	T	15: 4,948,709	I1320F	probably damaging	Het
Mug2	A	G	6: 122,081,610	T1324A	probably damaging	Het
Mylk	G	A	16: 34,899,402	V562M	possibly damaging	Het
Myo15b	G	A	11: 115,863,406	G911R		Het
Neo1	A	G	9: 58,913,166	Y825H	probably damaging	Het
Nfat5	T	G	8: 107,347,689	V343G	probably damaging	Het
Nlrp2	A	T	7: 5,327,888	I503K	possibly damaging	Het
Olfr180	A	T	16: 58,915,944	D232E	probably benign	Het
Olfr270	C	A	4: 52,970,790	H56Q	possibly damaging	Het
Olfr924	G	A	9: 38,848,917	E268K	probably benign	Het
Olfr975	G	A	9: 39,950,717	T18I	probably benign	Het
Pdcl2	T	C	5: 76,325,100	D7G	probably damaging	Het
Phyh	C	T	2: 4,919,082	R5C	probably damaging	Het
Prr11	A	C	11: 87,106,055	S28A	unknown	Het
Psmd13	T	A	7: 140,897,750	L190*	probably null	Het
Ptx4	A	G	17: 25,124,742	D322G	probably damaging	Het
Rnf40	T	C	7: 127,589,782	L109P	probably damaging	Het
Rrp1	T	C	10: 78,409,190	T102A	probably damaging	Het
Sema4a	T	G	3: 88,436,697	D749A	possibly damaging	Het
Serpina3f	A	T	12: 104,217,443	D188V	probably benign	Het
Smarca5	C	A	8: 80,716,508	A570S	probably damaging	Het
Spocd1	G	C	4: 129,930,204		probably null	Het
Stard9	G	A	2: 120,704,731	G3823D	probably benign	Het
Suco	A	G	1: 161,820,435	L1094S	probably damaging	Het
Tcf7	T	C	11: 52,260,594	D79G	probably damaging	Het
Tdrd12	A	G	7: 35,529,180	M39T	probably damaging	Het
Thnsl1	A	G	2: 21,212,398	N321S	probably benign	Het
Tmem132c	T	A	5: 127,360,153	Y235*	probably null	Het
Tnfaip6	T	C	2: 52,043,812	F60L	probably benign	Het
Tnpo3	T	C	6: 29,572,621	I411V	probably benign	Het
Trio	A	C	15: 27,851,837	V856G	possibly damaging	Het
Trpc2	C	G	7: 102,084,560	R239G	probably benign	Het
Ttn	C	T	2: 76,826,132	V12502I	unknown	Het
Usf3	A	G	16: 44,220,173	D1672G	probably damaging	Het
Usp24	A	G	4: 106,379,239	N1011S	probably benign	Het
Vac14	A	G	8: 110,719,887	E756G	probably benign	Het
Vmn2r41	A	G	7: 8,161,523	L10P	probably damaging	Het
Xrcc5	T	C	1: 72,314,178	M115T	probably damaging	Het
Zfp827	G	A	8: 79,189,834		probably benign	Het
Zmym1	A	T	4: 127,049,871	N241K	possibly damaging	Het

Other mutations in Filip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Filip1	APN	9	79817944	missense	probably damaging	1.00
IGL01101:Filip1	APN	9	79898246	missense	probably benign	0.44
IGL01301:Filip1	APN	9	79819180	missense	possibly damaging	0.93
IGL01887:Filip1	APN	9	79819617	missense	probably benign	0.42
IGL02119:Filip1	APN	9	79818266	missense	probably benign
IGL02285:Filip1	APN	9	79820126	missense	probably damaging	1.00
IGL02395:Filip1	APN	9	79898410	missense	probably benign	0.01
IGL03398:Filip1	APN	9	79818943	missense	probably benign	0.03
IGL03400:Filip1	APN	9	79820473	missense	probably benign	0.01
IGL03404:Filip1	APN	9	79818559	missense	probably damaging	0.99
ANU18:Filip1	UTSW	9	79819180	missense	possibly damaging	0.93
BB010:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
BB020:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R0101:Filip1	UTSW	9	79819528	missense	probably benign	0.04
R0243:Filip1	UTSW	9	79819003	missense	probably damaging	0.98
R0244:Filip1	UTSW	9	79819462	missense	possibly damaging	0.87
R0371:Filip1	UTSW	9	79860091	missense	probably damaging	1.00
R0399:Filip1	UTSW	9	79818310	missense	possibly damaging	0.71
R0412:Filip1	UTSW	9	79820289	missense	possibly damaging	0.59
R0671:Filip1	UTSW	9	79819390	missense	probably damaging	1.00
R1314:Filip1	UTSW	9	79820566	missense	probably damaging	1.00
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1602:Filip1	UTSW	9	79820591	missense	probably damaging	0.99
R1801:Filip1	UTSW	9	79815846	missense	probably damaging	0.98
R1929:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R1983:Filip1	UTSW	9	79860092	missense	probably damaging	1.00
R2066:Filip1	UTSW	9	79820216	missense	probably damaging	1.00
R2128:Filip1	UTSW	9	79819330	missense	probably damaging	0.99
R2271:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2411:Filip1	UTSW	9	79898433	missense	probably damaging	0.98
R3429:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3430:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3945:Filip1	UTSW	9	79818367	missense	probably benign	0.01
R4007:Filip1	UTSW	9	79818727	missense	possibly damaging	0.71
R4583:Filip1	UTSW	9	79815809	missense	possibly damaging	0.76
R4803:Filip1	UTSW	9	79820114	missense	probably benign	0.05
R4837:Filip1	UTSW	9	79819459	missense	probably damaging	0.98
R4910:Filip1	UTSW	9	79817932	missense	probably benign	0.00
R4929:Filip1	UTSW	9	79819747	missense	probably benign	0.07
R5387:Filip1	UTSW	9	79818274	missense	probably benign
R5581:Filip1	UTSW	9	79819760	missense	possibly damaging	0.95
R5808:Filip1	UTSW	9	79818701	missense	possibly damaging	0.67
R5891:Filip1	UTSW	9	79819860	missense	possibly damaging	0.69
R6166:Filip1	UTSW	9	79819454	missense	probably damaging	0.99
R6273:Filip1	UTSW	9	79815886	missense	probably benign	0.01
R6380:Filip1	UTSW	9	79819624	missense	probably damaging	0.99
R6385:Filip1	UTSW	9	79820531	missense	possibly damaging	0.68
R6614:Filip1	UTSW	9	79815839	missense	probably damaging	1.00
R6715:Filip1	UTSW	9	79818758	missense	probably benign	0.03
R7047:Filip1	UTSW	9	79853634	missense	probably damaging	0.98
R7126:Filip1	UTSW	9	79898295	missense	possibly damaging	0.88
R7144:Filip1	UTSW	9	79820213	missense	possibly damaging	0.65
R7218:Filip1	UTSW	9	79818074	missense	probably benign
R7404:Filip1	UTSW	9	79820098	missense	possibly damaging	0.94
R7702:Filip1	UTSW	9	79820649	missense	probably benign	0.20
R7866:Filip1	UTSW	9	79818943	missense	probably benign	0.03
R7933:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R8012:Filip1	UTSW	9	79817959	missense	probably damaging	0.97
R8097:Filip1	UTSW	9	79818259	missense	probably benign
R8213:Filip1	UTSW	9	79818092	missense	probably benign	0.01
R8305:Filip1	UTSW	9	79820475	nonsense	probably null
R9184:Filip1	UTSW	9	79898260	missense	probably benign	0.03
R9322:Filip1	UTSW	9	79819732	missense	probably benign	0.01
R9334:Filip1	UTSW	9	79818457	missense	probably benign	0.32
R9353:Filip1	UTSW	9	79818341	missense	possibly damaging	0.67
R9541:Filip1	UTSW	9	79819853	nonsense	probably null
R9607:Filip1	UTSW	9	79819120	missense	probably damaging	1.00
X0054:Filip1	UTSW	9	79819535	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTAACCCGACTCTTGACCAC -3'
(R):5'- TTGGCTTATCGCAAAGGATCG -3'

Sequencing Primer
(F):5'- GACCACCTCCAGCTCGTTCAG -3'
(R):5'- CTTATCGCAAAGGATCGAGGAACTG -3'

Posted On

2021-04-30