Incidental Mutation 'R8798:Ak9'
ID 671390
Institutional Source Beutler Lab
Gene Symbol Ak9
Ensembl Gene ENSMUSG00000091415
Gene Name adenylate kinase 9
Synonyms LOC215946, Akd1, Gm7127, Akd2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R8798 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 41303980-41434534 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41382851 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 781 (D781E)
Ref Sequence ENSEMBL: ENSMUSP00000134177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173494]
AlphaFold G3UYQ4
Predicted Effect
SMART Domains Protein: ENSMUSP00000134177
Gene: ENSMUSG00000091415
AA Change: D781E

DomainStartEndE-ValueType
AAA 30 330 4.65e-3 SMART
AAA 391 733 9.11e-1 SMART
Pfam:DUF3508 812 971 1.4e-7 PFAM
AAA 974 1297 1.2e-1 SMART
Blast:AAA 1326 1388 8e-18 BLAST
AAA 1393 1824 1.44e0 SMART
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the interconversion of nucleosides, possessing both nucleoside monophosphate and diphosphate kinase activities. The encoded protein uses these interconversions to maintain nucleoside homeostasis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik G A 8: 79,210,751 R176* probably null Het
2610044O15Rik8 G A 8: 129,219,298 H349Y probably damaging Het
4921539E11Rik A C 4: 103,266,377 probably benign Het
A430078G23Rik T A 8: 3,364,645 Y8N probably benign Het
Abcc2 A G 19: 43,808,666 N492S probably benign Het
Acox1 T C 11: 116,174,357 Y624C probably damaging Het
Aff4 T C 11: 53,400,508 probably benign Het
Arfgef3 T C 10: 18,647,051 D409G probably damaging Het
Blnk A G 19: 40,962,351 Y119H probably damaging Het
Brsk2 T C 7: 141,987,864 L310P probably damaging Het
Cit T A 5: 115,969,043 L1078Q probably damaging Het
Cpn1 A T 19: 43,986,236 V18D possibly damaging Het
Csmd3 A T 15: 47,731,986 Y1115N Het
Dnah9 A C 11: 65,905,231 V3589G probably damaging Het
Dpp9 T C 17: 56,199,037 Y454C probably damaging Het
Eif3i A G 4: 129,596,924 V67A probably benign Het
Eif6 T C 2: 155,822,966 N200S probably damaging Het
Fbxo10 T C 4: 45,051,605 H502R possibly damaging Het
Fcer1a A G 1: 173,225,480 Y50H probably benign Het
Filip1 G A 9: 79,820,090 H416Y possibly damaging Het
Frmpd1 A T 4: 45,285,424 N1415I possibly damaging Het
Gdpgp1 C T 7: 80,238,977 P252L probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gsap T C 5: 21,271,250 probably null Het
Hgs T C 11: 120,480,112 V598A probably benign Het
Irf2 G T 8: 46,807,314 V94L probably benign Het
Kalrn G T 16: 33,982,855 H2675Q possibly damaging Het
Klhl33 C A 14: 50,893,108 A50S possibly damaging Het
Klk1b11 T C 7: 43,995,948 I15T probably benign Het
Lrrn3 A G 12: 41,453,175 M381T possibly damaging Het
Ltbr A G 6: 125,307,295 Y395H probably benign Het
Ltf A G 9: 111,023,760 probably benign Het
Ly75 A G 2: 60,323,926 F1059S probably benign Het
Lypd6 T A 2: 50,188,762 I90N possibly damaging Het
Map1a G A 2: 121,302,287 V1195M probably benign Het
Mb21d1 G A 9: 78,443,066 R5C probably benign Het
Mroh2b A T 15: 4,948,709 I1320F probably damaging Het
Mug2 A G 6: 122,081,610 T1324A probably damaging Het
Mylk G A 16: 34,899,402 V562M possibly damaging Het
Myo15b G A 11: 115,863,406 G911R Het
Neo1 A G 9: 58,913,166 Y825H probably damaging Het
Nfat5 T G 8: 107,347,689 V343G probably damaging Het
Nlrp2 A T 7: 5,327,888 I503K possibly damaging Het
Olfr180 A T 16: 58,915,944 D232E probably benign Het
Olfr270 C A 4: 52,970,790 H56Q possibly damaging Het
Olfr924 G A 9: 38,848,917 E268K probably benign Het
Olfr975 G A 9: 39,950,717 T18I probably benign Het
Pdcl2 T C 5: 76,325,100 D7G probably damaging Het
Phyh C T 2: 4,919,082 R5C probably damaging Het
Prr11 A C 11: 87,106,055 S28A unknown Het
Psmd13 T A 7: 140,897,750 L190* probably null Het
Ptx4 A G 17: 25,124,742 D322G probably damaging Het
Rnf40 T C 7: 127,589,782 L109P probably damaging Het
Rrp1 T C 10: 78,409,190 T102A probably damaging Het
Sema4a T G 3: 88,436,697 D749A possibly damaging Het
Serpina3f A T 12: 104,217,443 D188V probably benign Het
Smarca5 C A 8: 80,716,508 A570S probably damaging Het
Spocd1 G C 4: 129,930,204 probably null Het
Stard9 G A 2: 120,704,731 G3823D probably benign Het
Suco A G 1: 161,820,435 L1094S probably damaging Het
Tcf7 T C 11: 52,260,594 D79G probably damaging Het
Tdrd12 A G 7: 35,529,180 M39T probably damaging Het
Thnsl1 A G 2: 21,212,398 N321S probably benign Het
Tmem132c T A 5: 127,360,153 Y235* probably null Het
Tnfaip6 T C 2: 52,043,812 F60L probably benign Het
Tnpo3 T C 6: 29,572,621 I411V probably benign Het
Trio A C 15: 27,851,837 V856G possibly damaging Het
Trpc2 C G 7: 102,084,560 R239G probably benign Het
Ttn C T 2: 76,826,132 V12502I unknown Het
Usf3 A G 16: 44,220,173 D1672G probably damaging Het
Usp24 A G 4: 106,379,239 N1011S probably benign Het
Vac14 A G 8: 110,719,887 E756G probably benign Het
Vmn2r41 A G 7: 8,161,523 L10P probably damaging Het
Xrcc5 T C 1: 72,314,178 M115T probably damaging Het
Zfp827 G A 8: 79,189,834 probably benign Het
Zmym1 A T 4: 127,049,871 N241K possibly damaging Het
Other mutations in Ak9
AlleleSourceChrCoordTypePredicted EffectPPH Score
Mean UTSW 10 41357563 missense possibly damaging 0.59
BB006:Ak9 UTSW 10 41383948 missense
BB016:Ak9 UTSW 10 41383948 missense
R0057:Ak9 UTSW 10 41392728 missense probably benign 0.04
R0605:Ak9 UTSW 10 41345139 missense probably damaging 1.00
R0658:Ak9 UTSW 10 41347222 missense probably damaging 0.98
R1696:Ak9 UTSW 10 41327589 missense possibly damaging 0.73
R1738:Ak9 UTSW 10 41335921 missense possibly damaging 0.86
R1815:Ak9 UTSW 10 41337576 missense probably damaging 1.00
R2900:Ak9 UTSW 10 41424755 missense unknown
R3123:Ak9 UTSW 10 41358580 missense possibly damaging 0.46
R3715:Ak9 UTSW 10 41357512 missense probably damaging 0.96
R4092:Ak9 UTSW 10 41389144 missense probably benign 0.29
R4193:Ak9 UTSW 10 41335945 missense probably benign 0.14
R4598:Ak9 UTSW 10 41383911 missense probably damaging 1.00
R4621:Ak9 UTSW 10 41406891 missense possibly damaging 0.55
R4681:Ak9 UTSW 10 41427238 missense unknown
R4707:Ak9 UTSW 10 41345460 missense probably benign 0.36
R4908:Ak9 UTSW 10 41420682 missense unknown
R4952:Ak9 UTSW 10 41420589 missense probably benign 0.07
R5162:Ak9 UTSW 10 41357657 missense probably damaging 1.00
R5446:Ak9 UTSW 10 41420509 missense possibly damaging 0.70
R5494:Ak9 UTSW 10 41347169 missense probably damaging 1.00
R5517:Ak9 UTSW 10 41340891 missense probably benign 0.23
R5849:Ak9 UTSW 10 41348049 missense probably benign 0.31
R5858:Ak9 UTSW 10 41423027 missense unknown
R5920:Ak9 UTSW 10 41420676 missense probably benign 0.30
R5952:Ak9 UTSW 10 41357563 missense possibly damaging 0.59
R5955:Ak9 UTSW 10 41358564 missense probably damaging 1.00
R6050:Ak9 UTSW 10 41389112 missense possibly damaging 0.74
R6087:Ak9 UTSW 10 41382832 missense probably benign 0.01
R6190:Ak9 UTSW 10 41422407 missense unknown
R6190:Ak9 UTSW 10 41422408 missense unknown
R6197:Ak9 UTSW 10 41317830 missense probably damaging 0.98
R6220:Ak9 UTSW 10 41370099 missense unknown
R6250:Ak9 UTSW 10 41389034 missense possibly damaging 0.54
R6315:Ak9 UTSW 10 41406841 missense possibly damaging 0.55
R6331:Ak9 UTSW 10 41382829 missense probably damaging 0.99
R6812:Ak9 UTSW 10 41367167 missense unknown
R6847:Ak9 UTSW 10 41357801 splice site probably null
R7128:Ak9 UTSW 10 41424717 missense unknown
R7253:Ak9 UTSW 10 41432484 missense unknown
R7286:Ak9 UTSW 10 41407371 missense
R7401:Ak9 UTSW 10 41423004 missense unknown
R7478:Ak9 UTSW 10 41389091 missense
R7698:Ak9 UTSW 10 41348076 missense
R7758:Ak9 UTSW 10 41347132 missense
R7806:Ak9 UTSW 10 41433084 critical splice acceptor site probably null
R7894:Ak9 UTSW 10 41420539 missense unknown
R7929:Ak9 UTSW 10 41383948 missense
R7941:Ak9 UTSW 10 41409137 missense unknown
R8032:Ak9 UTSW 10 41424620 missense unknown
R8143:Ak9 UTSW 10 41337592 nonsense probably null
R8298:Ak9 UTSW 10 41389058 missense
R8301:Ak9 UTSW 10 41424716 missense
R8355:Ak9 UTSW 10 41399704 missense
R8703:Ak9 UTSW 10 41325124 missense
R8728:Ak9 UTSW 10 41406963 missense
R8757:Ak9 UTSW 10 41423040 missense unknown
R8868:Ak9 UTSW 10 41317846 critical splice donor site probably null
R8868:Ak9 UTSW 10 41382873 nonsense probably null
R9088:Ak9 UTSW 10 41406874 missense
R9090:Ak9 UTSW 10 41424627 missense unknown
R9165:Ak9 UTSW 10 41433239 missense unknown
R9195:Ak9 UTSW 10 41407483 missense
R9271:Ak9 UTSW 10 41424627 missense unknown
R9297:Ak9 UTSW 10 41423085 missense unknown
R9302:Ak9 UTSW 10 41320490 missense
R9309:Ak9 UTSW 10 41316368 critical splice donor site probably null
R9318:Ak9 UTSW 10 41423085 missense unknown
R9393:Ak9 UTSW 10 41409072 missense unknown
Z1176:Ak9 UTSW 10 41348251 missense
Z1176:Ak9 UTSW 10 41423023 missense unknown
Predicted Primers PCR Primer
(F):5'- GACTGGCTACATCGAGACTG -3'
(R):5'- CTGATGAGTGAAATTCGTATGGAAGC -3'

Sequencing Primer
(F):5'- GGCTACATCGAGACTGTCTTTCTG -3'
(R):5'- CAGATGAAACAGTTAAAACAGTGTTG -3'
Posted On 2021-04-30