Incidental Mutation 'R8798:Aff4'
ID 671393
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8798 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation critical splice donor site
DNA Base Change (assembly) T to C at 53400508 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect probably benign
Transcript: ENSMUST00000060945
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152616
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik G A 8: 79,210,751 R176* probably null Het
2610044O15Rik8 G A 8: 129,219,298 H349Y probably damaging Het
4921539E11Rik A C 4: 103,266,377 probably benign Het
A430078G23Rik T A 8: 3,364,645 Y8N probably benign Het
Abcc2 A G 19: 43,808,666 N492S probably benign Het
Acox1 T C 11: 116,174,357 Y624C probably damaging Het
Ak9 T A 10: 41,382,851 D781E Het
Arfgef3 T C 10: 18,647,051 D409G probably damaging Het
Blnk A G 19: 40,962,351 Y119H probably damaging Het
Brsk2 T C 7: 141,987,864 L310P probably damaging Het
Cit T A 5: 115,969,043 L1078Q probably damaging Het
Cpn1 A T 19: 43,986,236 V18D possibly damaging Het
Csmd3 A T 15: 47,731,986 Y1115N Het
Dnah9 A C 11: 65,905,231 V3589G probably damaging Het
Dpp9 T C 17: 56,199,037 Y454C probably damaging Het
Eif3i A G 4: 129,596,924 V67A probably benign Het
Eif6 T C 2: 155,822,966 N200S probably damaging Het
Fbxo10 T C 4: 45,051,605 H502R possibly damaging Het
Fcer1a A G 1: 173,225,480 Y50H probably benign Het
Filip1 G A 9: 79,820,090 H416Y possibly damaging Het
Frmpd1 A T 4: 45,285,424 N1415I possibly damaging Het
Gdpgp1 C T 7: 80,238,977 P252L probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gsap T C 5: 21,271,250 probably null Het
Hgs T C 11: 120,480,112 V598A probably benign Het
Irf2 G T 8: 46,807,314 V94L probably benign Het
Kalrn G T 16: 33,982,855 H2675Q possibly damaging Het
Klhl33 C A 14: 50,893,108 A50S possibly damaging Het
Klk1b11 T C 7: 43,995,948 I15T probably benign Het
Lrrn3 A G 12: 41,453,175 M381T possibly damaging Het
Ltbr A G 6: 125,307,295 Y395H probably benign Het
Ltf A G 9: 111,023,760 probably benign Het
Ly75 A G 2: 60,323,926 F1059S probably benign Het
Lypd6 T A 2: 50,188,762 I90N possibly damaging Het
Map1a G A 2: 121,302,287 V1195M probably benign Het
Mb21d1 G A 9: 78,443,066 R5C probably benign Het
Mroh2b A T 15: 4,948,709 I1320F probably damaging Het
Mug2 A G 6: 122,081,610 T1324A probably damaging Het
Mylk G A 16: 34,899,402 V562M possibly damaging Het
Myo15b G A 11: 115,863,406 G911R Het
Neo1 A G 9: 58,913,166 Y825H probably damaging Het
Nfat5 T G 8: 107,347,689 V343G probably damaging Het
Nlrp2 A T 7: 5,327,888 I503K possibly damaging Het
Olfr180 A T 16: 58,915,944 D232E probably benign Het
Olfr270 C A 4: 52,970,790 H56Q possibly damaging Het
Olfr924 G A 9: 38,848,917 E268K probably benign Het
Olfr975 G A 9: 39,950,717 T18I probably benign Het
Pdcl2 T C 5: 76,325,100 D7G probably damaging Het
Phyh C T 2: 4,919,082 R5C probably damaging Het
Prr11 A C 11: 87,106,055 S28A unknown Het
Psmd13 T A 7: 140,897,750 L190* probably null Het
Ptx4 A G 17: 25,124,742 D322G probably damaging Het
Rnf40 T C 7: 127,589,782 L109P probably damaging Het
Rrp1 T C 10: 78,409,190 T102A probably damaging Het
Sema4a T G 3: 88,436,697 D749A possibly damaging Het
Serpina3f A T 12: 104,217,443 D188V probably benign Het
Smarca5 C A 8: 80,716,508 A570S probably damaging Het
Spocd1 G C 4: 129,930,204 probably null Het
Stard9 G A 2: 120,704,731 G3823D probably benign Het
Suco A G 1: 161,820,435 L1094S probably damaging Het
Tcf7 T C 11: 52,260,594 D79G probably damaging Het
Tdrd12 A G 7: 35,529,180 M39T probably damaging Het
Thnsl1 A G 2: 21,212,398 N321S probably benign Het
Tmem132c T A 5: 127,360,153 Y235* probably null Het
Tnfaip6 T C 2: 52,043,812 F60L probably benign Het
Tnpo3 T C 6: 29,572,621 I411V probably benign Het
Trio A C 15: 27,851,837 V856G possibly damaging Het
Trpc2 C G 7: 102,084,560 R239G probably benign Het
Ttn C T 2: 76,826,132 V12502I unknown Het
Usf3 A G 16: 44,220,173 D1672G probably damaging Het
Usp24 A G 4: 106,379,239 N1011S probably benign Het
Vac14 A G 8: 110,719,887 E756G probably benign Het
Vmn2r41 A G 7: 8,161,523 L10P probably damaging Het
Xrcc5 T C 1: 72,314,178 M115T probably damaging Het
Zfp827 G A 8: 79,189,834 probably benign Het
Zmym1 A T 4: 127,049,871 N241K possibly damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATGACAGGTATCCACTCATTGTG -3'
(R):5'- CAGATGCTGGTATCTAAACATGAAC -3'

Sequencing Primer
(F):5'- GTTCCAGAGAAACACTCG -3'
(R):5'- GGACACTTGCTATTCTTCAAGCAGG -3'
Posted On 2021-04-30