Incidental Mutation 'R8798:Lrrn3'
ID 671399
Institutional Source Beutler Lab
Gene Symbol Lrrn3
Ensembl Gene ENSMUSG00000036295
Gene Name leucine rich repeat protein 3, neuronal
Synonyms NLRR-3
MMRRC Submission 068724-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R8798 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 41501667-41536056 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41503174 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 381 (M381T)
Ref Sequence ENSEMBL: ENSMUSP00000043818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]
AlphaFold Q8CBC6
Predicted Effect possibly damaging
Transcript: ENSMUST00000043884
AA Change: M381T

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: M381T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 28 73 9.17e-4 SMART
LRR 115 138 2.63e0 SMART
LRR_TYP 139 162 1.5e-4 SMART
LRR 163 186 7.55e-1 SMART
LRR 187 210 1.76e1 SMART
LRR 211 234 1.62e1 SMART
LRR 235 258 5.11e0 SMART
LRR 260 282 3.18e1 SMART
LRR 333 356 4.44e0 SMART
LRRCT 368 420 3.7e-5 SMART
IGc2 435 503 5.04e-9 SMART
FN3 521 602 3.49e0 SMART
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132121
SMART Domains Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 115 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134965
SMART Domains Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 114 6.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (74/74)
MGI Phenotype PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik G A 8: 79,937,380 (GRCm39) R176* probably null Het
4921539E11Rik A C 4: 103,123,574 (GRCm39) probably benign Het
Abcc2 A G 19: 43,797,105 (GRCm39) N492S probably benign Het
Acox1 T C 11: 116,065,183 (GRCm39) Y624C probably damaging Het
Aff4 T C 11: 53,291,335 (GRCm39) probably benign Het
Ak9 T A 10: 41,258,847 (GRCm39) D781E Het
Arfgef3 T C 10: 18,522,799 (GRCm39) D409G probably damaging Het
Arhgef18 T A 8: 3,414,645 (GRCm39) Y8N probably benign Het
Blnk A G 19: 40,950,795 (GRCm39) Y119H probably damaging Het
Brsk2 T C 7: 141,541,601 (GRCm39) L310P probably damaging Het
Cgas G A 9: 78,350,348 (GRCm39) R5C probably benign Het
Cit T A 5: 116,107,102 (GRCm39) L1078Q probably damaging Het
Cpn1 A T 19: 43,974,675 (GRCm39) V18D possibly damaging Het
Csmd3 A T 15: 47,595,382 (GRCm39) Y1115N Het
Dnah9 A C 11: 65,796,057 (GRCm39) V3589G probably damaging Het
Dpp9 T C 17: 56,506,037 (GRCm39) Y454C probably damaging Het
Eif3i A G 4: 129,490,717 (GRCm39) V67A probably benign Het
Eif6 T C 2: 155,664,886 (GRCm39) N200S probably damaging Het
Fbxo10 T C 4: 45,051,605 (GRCm39) H502R possibly damaging Het
Fcer1a A G 1: 173,053,047 (GRCm39) Y50H probably benign Het
Filip1 G A 9: 79,727,372 (GRCm39) H416Y possibly damaging Het
Frmpd1 A T 4: 45,285,424 (GRCm39) N1415I possibly damaging Het
Gdpgp1 C T 7: 79,888,725 (GRCm39) P252L probably damaging Het
Gsap T C 5: 21,476,248 (GRCm39) probably null Het
Hgs T C 11: 120,370,938 (GRCm39) V598A probably benign Het
Irf2 G T 8: 47,260,349 (GRCm39) V94L probably benign Het
Kalrn G T 16: 33,803,225 (GRCm39) H2675Q possibly damaging Het
Klhl33 C A 14: 51,130,565 (GRCm39) A50S possibly damaging Het
Klk1b11 T C 7: 43,645,372 (GRCm39) I15T probably benign Het
Lcor C T 19: 41,573,698 (GRCm39) R818W probably damaging Het
Ltbr A G 6: 125,284,258 (GRCm39) Y395H probably benign Het
Ltf A G 9: 110,852,828 (GRCm39) probably benign Het
Ly75 A G 2: 60,154,270 (GRCm39) F1059S probably benign Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Map1a G A 2: 121,132,768 (GRCm39) V1195M probably benign Het
Mroh2b A T 15: 4,978,191 (GRCm39) I1320F probably damaging Het
Mug2 A G 6: 122,058,569 (GRCm39) T1324A probably damaging Het
Mylk G A 16: 34,719,772 (GRCm39) V562M possibly damaging Het
Myo15b G A 11: 115,754,232 (GRCm39) G911R Het
Neo1 A G 9: 58,820,449 (GRCm39) Y825H probably damaging Het
Nfat5 T G 8: 108,074,321 (GRCm39) V343G probably damaging Het
Nlrp2 A T 7: 5,330,887 (GRCm39) I503K possibly damaging Het
Or10d5 G A 9: 39,862,013 (GRCm39) T18I probably benign Het
Or13d1 C A 4: 52,970,790 (GRCm39) H56Q possibly damaging Het
Or5k16 A T 16: 58,736,307 (GRCm39) D232E probably benign Het
Or8d2 G A 9: 38,760,213 (GRCm39) E268K probably benign Het
Pdcl2 T C 5: 76,472,947 (GRCm39) D7G probably damaging Het
Phyh C T 2: 4,923,893 (GRCm39) R5C probably damaging Het
Prr11 A C 11: 86,996,881 (GRCm39) S28A unknown Het
Psmd13 T A 7: 140,477,663 (GRCm39) L190* probably null Het
Ptx4 A G 17: 25,343,716 (GRCm39) D322G probably damaging Het
Rnf40 T C 7: 127,188,954 (GRCm39) L109P probably damaging Het
Rrp1 T C 10: 78,245,024 (GRCm39) T102A probably damaging Het
Sema4a T G 3: 88,344,004 (GRCm39) D749A possibly damaging Het
Serpina3f A T 12: 104,183,702 (GRCm39) D188V probably benign Het
Smarca5 C A 8: 81,443,137 (GRCm39) A570S probably damaging Het
Spocd1 G C 4: 129,823,997 (GRCm39) probably null Het
Stard9 G A 2: 120,535,212 (GRCm39) G3823D probably benign Het
Suco A G 1: 161,648,004 (GRCm39) L1094S probably damaging Het
Tcf7 T C 11: 52,151,421 (GRCm39) D79G probably damaging Het
Tdrd12 A G 7: 35,228,605 (GRCm39) M39T probably damaging Het
Thnsl1 A G 2: 21,217,209 (GRCm39) N321S probably benign Het
Tmem132c T A 5: 127,437,217 (GRCm39) Y235* probably null Het
Tnfaip6 T C 2: 51,933,824 (GRCm39) F60L probably benign Het
Tnpo3 T C 6: 29,572,620 (GRCm39) I411V probably benign Het
Trio A C 15: 27,851,923 (GRCm39) V856G possibly damaging Het
Trpc2 C G 7: 101,733,767 (GRCm39) R239G probably benign Het
Ttn C T 2: 76,656,476 (GRCm39) V12502I unknown Het
Usf3 A G 16: 44,040,536 (GRCm39) D1672G probably damaging Het
Usp24 A G 4: 106,236,436 (GRCm39) N1011S probably benign Het
Vac14 A G 8: 111,446,519 (GRCm39) E756G probably benign Het
Vmn2r41 A G 7: 8,164,522 (GRCm39) L10P probably damaging Het
Xrcc5 T C 1: 72,353,337 (GRCm39) M115T probably damaging Het
Zfp1006 G A 8: 129,945,779 (GRCm39) H349Y probably damaging Het
Zfp827 G A 8: 79,916,463 (GRCm39) probably benign Het
Zmym1 A T 4: 126,943,664 (GRCm39) N241K possibly damaging Het
Other mutations in Lrrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Lrrn3 APN 12 41,502,191 (GRCm39) intron probably benign
IGL02825:Lrrn3 APN 12 41,502,592 (GRCm39) missense probably damaging 1.00
IGL02927:Lrrn3 APN 12 41,503,343 (GRCm39) missense probably damaging 1.00
IGL02970:Lrrn3 APN 12 41,502,359 (GRCm39) missense probably benign
IGL02995:Lrrn3 APN 12 41,502,216 (GRCm39) missense probably damaging 1.00
IGL02999:Lrrn3 APN 12 41,502,750 (GRCm39) missense probably benign 0.01
IGL03182:Lrrn3 APN 12 41,504,020 (GRCm39) missense probably damaging 1.00
IGL03280:Lrrn3 APN 12 41,504,146 (GRCm39) missense probably damaging 0.97
PIT4469001:Lrrn3 UTSW 12 41,503,017 (GRCm39) missense probably benign 0.03
R0167:Lrrn3 UTSW 12 41,504,014 (GRCm39) missense probably damaging 1.00
R0414:Lrrn3 UTSW 12 41,503,939 (GRCm39) missense probably damaging 1.00
R0787:Lrrn3 UTSW 12 41,504,230 (GRCm39) missense probably damaging 1.00
R0894:Lrrn3 UTSW 12 41,504,033 (GRCm39) missense probably damaging 1.00
R1433:Lrrn3 UTSW 12 41,502,583 (GRCm39) missense possibly damaging 0.74
R1610:Lrrn3 UTSW 12 41,502,992 (GRCm39) missense possibly damaging 0.89
R1834:Lrrn3 UTSW 12 41,503,517 (GRCm39) missense probably damaging 1.00
R2068:Lrrn3 UTSW 12 41,502,995 (GRCm39) missense probably damaging 1.00
R2871:Lrrn3 UTSW 12 41,502,722 (GRCm39) missense probably benign 0.00
R2871:Lrrn3 UTSW 12 41,502,722 (GRCm39) missense probably benign 0.00
R3771:Lrrn3 UTSW 12 41,502,869 (GRCm39) missense probably damaging 1.00
R4408:Lrrn3 UTSW 12 41,504,041 (GRCm39) missense probably benign 0.04
R4410:Lrrn3 UTSW 12 41,502,583 (GRCm39) missense possibly damaging 0.74
R4684:Lrrn3 UTSW 12 41,504,243 (GRCm39) missense possibly damaging 0.75
R4770:Lrrn3 UTSW 12 41,502,442 (GRCm39) missense probably benign 0.08
R4927:Lrrn3 UTSW 12 41,503,124 (GRCm39) missense probably damaging 1.00
R5037:Lrrn3 UTSW 12 41,503,594 (GRCm39) missense probably damaging 1.00
R5482:Lrrn3 UTSW 12 41,502,387 (GRCm39) missense probably damaging 0.96
R5482:Lrrn3 UTSW 12 41,502,386 (GRCm39) missense probably benign 0.01
R5667:Lrrn3 UTSW 12 41,502,297 (GRCm39) missense possibly damaging 0.77
R6022:Lrrn3 UTSW 12 41,503,429 (GRCm39) missense probably damaging 0.96
R6087:Lrrn3 UTSW 12 41,503,534 (GRCm39) missense possibly damaging 0.84
R6129:Lrrn3 UTSW 12 41,503,787 (GRCm39) nonsense probably null
R6309:Lrrn3 UTSW 12 41,503,205 (GRCm39) missense probably damaging 1.00
R7449:Lrrn3 UTSW 12 41,503,487 (GRCm39) missense probably damaging 1.00
R7555:Lrrn3 UTSW 12 41,502,910 (GRCm39) missense probably benign 0.01
R7560:Lrrn3 UTSW 12 41,502,712 (GRCm39) missense possibly damaging 0.93
R8059:Lrrn3 UTSW 12 41,504,216 (GRCm39) missense probably benign 0.22
R8134:Lrrn3 UTSW 12 41,503,047 (GRCm39) missense probably damaging 1.00
R9308:Lrrn3 UTSW 12 41,503,945 (GRCm39) missense probably damaging 1.00
R9318:Lrrn3 UTSW 12 41,503,243 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTTCTACATCCAGGTCAG -3'
(R):5'- TCGCTGTGGATAACTTGCCAG -3'

Sequencing Primer
(F):5'- TCCAGGTCAGAAGGAAAGCTCTC -3'
(R):5'- CTGTGGATAACTTGCCAGATTTGAG -3'
Posted On 2021-04-30