Incidental Mutation 'R8798:Mylk'
ID 671406
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210
MMRRC Submission 068724-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8798 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 34565580-34822790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34719772 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 562 (V562M)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000023538
AA Change: V562M

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: V562M

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik G A 8: 79,937,380 (GRCm39) R176* probably null Het
4921539E11Rik A C 4: 103,123,574 (GRCm39) probably benign Het
Abcc2 A G 19: 43,797,105 (GRCm39) N492S probably benign Het
Acox1 T C 11: 116,065,183 (GRCm39) Y624C probably damaging Het
Aff4 T C 11: 53,291,335 (GRCm39) probably benign Het
Ak9 T A 10: 41,258,847 (GRCm39) D781E Het
Arfgef3 T C 10: 18,522,799 (GRCm39) D409G probably damaging Het
Arhgef18 T A 8: 3,414,645 (GRCm39) Y8N probably benign Het
Blnk A G 19: 40,950,795 (GRCm39) Y119H probably damaging Het
Brsk2 T C 7: 141,541,601 (GRCm39) L310P probably damaging Het
Cgas G A 9: 78,350,348 (GRCm39) R5C probably benign Het
Cit T A 5: 116,107,102 (GRCm39) L1078Q probably damaging Het
Cpn1 A T 19: 43,974,675 (GRCm39) V18D possibly damaging Het
Csmd3 A T 15: 47,595,382 (GRCm39) Y1115N Het
Dnah9 A C 11: 65,796,057 (GRCm39) V3589G probably damaging Het
Dpp9 T C 17: 56,506,037 (GRCm39) Y454C probably damaging Het
Eif3i A G 4: 129,490,717 (GRCm39) V67A probably benign Het
Eif6 T C 2: 155,664,886 (GRCm39) N200S probably damaging Het
Fbxo10 T C 4: 45,051,605 (GRCm39) H502R possibly damaging Het
Fcer1a A G 1: 173,053,047 (GRCm39) Y50H probably benign Het
Filip1 G A 9: 79,727,372 (GRCm39) H416Y possibly damaging Het
Frmpd1 A T 4: 45,285,424 (GRCm39) N1415I possibly damaging Het
Gdpgp1 C T 7: 79,888,725 (GRCm39) P252L probably damaging Het
Gsap T C 5: 21,476,248 (GRCm39) probably null Het
Hgs T C 11: 120,370,938 (GRCm39) V598A probably benign Het
Irf2 G T 8: 47,260,349 (GRCm39) V94L probably benign Het
Kalrn G T 16: 33,803,225 (GRCm39) H2675Q possibly damaging Het
Klhl33 C A 14: 51,130,565 (GRCm39) A50S possibly damaging Het
Klk1b11 T C 7: 43,645,372 (GRCm39) I15T probably benign Het
Lcor C T 19: 41,573,698 (GRCm39) R818W probably damaging Het
Lrrn3 A G 12: 41,503,174 (GRCm39) M381T possibly damaging Het
Ltbr A G 6: 125,284,258 (GRCm39) Y395H probably benign Het
Ltf A G 9: 110,852,828 (GRCm39) probably benign Het
Ly75 A G 2: 60,154,270 (GRCm39) F1059S probably benign Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Map1a G A 2: 121,132,768 (GRCm39) V1195M probably benign Het
Mroh2b A T 15: 4,978,191 (GRCm39) I1320F probably damaging Het
Mug2 A G 6: 122,058,569 (GRCm39) T1324A probably damaging Het
Myo15b G A 11: 115,754,232 (GRCm39) G911R Het
Neo1 A G 9: 58,820,449 (GRCm39) Y825H probably damaging Het
Nfat5 T G 8: 108,074,321 (GRCm39) V343G probably damaging Het
Nlrp2 A T 7: 5,330,887 (GRCm39) I503K possibly damaging Het
Or10d5 G A 9: 39,862,013 (GRCm39) T18I probably benign Het
Or13d1 C A 4: 52,970,790 (GRCm39) H56Q possibly damaging Het
Or5k16 A T 16: 58,736,307 (GRCm39) D232E probably benign Het
Or8d2 G A 9: 38,760,213 (GRCm39) E268K probably benign Het
Pdcl2 T C 5: 76,472,947 (GRCm39) D7G probably damaging Het
Phyh C T 2: 4,923,893 (GRCm39) R5C probably damaging Het
Prr11 A C 11: 86,996,881 (GRCm39) S28A unknown Het
Psmd13 T A 7: 140,477,663 (GRCm39) L190* probably null Het
Ptx4 A G 17: 25,343,716 (GRCm39) D322G probably damaging Het
Rnf40 T C 7: 127,188,954 (GRCm39) L109P probably damaging Het
Rrp1 T C 10: 78,245,024 (GRCm39) T102A probably damaging Het
Sema4a T G 3: 88,344,004 (GRCm39) D749A possibly damaging Het
Serpina3f A T 12: 104,183,702 (GRCm39) D188V probably benign Het
Smarca5 C A 8: 81,443,137 (GRCm39) A570S probably damaging Het
Spocd1 G C 4: 129,823,997 (GRCm39) probably null Het
Stard9 G A 2: 120,535,212 (GRCm39) G3823D probably benign Het
Suco A G 1: 161,648,004 (GRCm39) L1094S probably damaging Het
Tcf7 T C 11: 52,151,421 (GRCm39) D79G probably damaging Het
Tdrd12 A G 7: 35,228,605 (GRCm39) M39T probably damaging Het
Thnsl1 A G 2: 21,217,209 (GRCm39) N321S probably benign Het
Tmem132c T A 5: 127,437,217 (GRCm39) Y235* probably null Het
Tnfaip6 T C 2: 51,933,824 (GRCm39) F60L probably benign Het
Tnpo3 T C 6: 29,572,620 (GRCm39) I411V probably benign Het
Trio A C 15: 27,851,923 (GRCm39) V856G possibly damaging Het
Trpc2 C G 7: 101,733,767 (GRCm39) R239G probably benign Het
Ttn C T 2: 76,656,476 (GRCm39) V12502I unknown Het
Usf3 A G 16: 44,040,536 (GRCm39) D1672G probably damaging Het
Usp24 A G 4: 106,236,436 (GRCm39) N1011S probably benign Het
Vac14 A G 8: 111,446,519 (GRCm39) E756G probably benign Het
Vmn2r41 A G 7: 8,164,522 (GRCm39) L10P probably damaging Het
Xrcc5 T C 1: 72,353,337 (GRCm39) M115T probably damaging Het
Zfp1006 G A 8: 129,945,779 (GRCm39) H349Y probably damaging Het
Zfp827 G A 8: 79,916,463 (GRCm39) probably benign Het
Zmym1 A T 4: 126,943,664 (GRCm39) N241K possibly damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34,759,322 (GRCm39) missense probably benign 0.36
IGL01386:Mylk APN 16 34,791,610 (GRCm39) critical splice acceptor site probably null
IGL01684:Mylk APN 16 34,792,310 (GRCm39) missense possibly damaging 0.55
IGL01884:Mylk APN 16 34,809,247 (GRCm39) splice site probably benign
IGL02079:Mylk APN 16 34,681,001 (GRCm39) missense possibly damaging 0.87
IGL02104:Mylk APN 16 34,635,805 (GRCm39) missense probably benign 0.06
IGL02624:Mylk APN 16 34,750,266 (GRCm39) missense probably benign 0.29
IGL02756:Mylk APN 16 34,784,016 (GRCm39) missense probably benign 0.42
IGL02794:Mylk APN 16 34,806,911 (GRCm39) missense probably benign 0.21
IGL02833:Mylk APN 16 34,735,270 (GRCm39) missense probably benign 0.01
IGL02946:Mylk APN 16 34,742,158 (GRCm39) missense probably benign 0.10
IGL03012:Mylk APN 16 34,773,151 (GRCm39) missense probably benign 0.03
IGL03093:Mylk APN 16 34,732,562 (GRCm39) missense possibly damaging 0.62
IGL03272:Mylk APN 16 34,799,559 (GRCm39) missense probably benign 0.09
billy UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
brutus UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
Club UTSW 16 34,732,645 (GRCm39) nonsense probably null
popeye UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
F5770:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34,797,483 (GRCm39) splice site probably benign
PIT4382001:Mylk UTSW 16 34,696,012 (GRCm39) missense probably damaging 0.99
R0131:Mylk UTSW 16 34,695,874 (GRCm39) missense probably benign 0.03
R0309:Mylk UTSW 16 34,732,667 (GRCm39) splice site probably benign
R0358:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0381:Mylk UTSW 16 34,605,344 (GRCm39) splice site probably null
R0390:Mylk UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
R0413:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.01
R0536:Mylk UTSW 16 34,820,757 (GRCm39) missense possibly damaging 0.95
R0544:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0545:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0546:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0547:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0548:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0627:Mylk UTSW 16 34,820,799 (GRCm39) missense probably damaging 1.00
R0726:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0755:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0782:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0783:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0784:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1136:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R1170:Mylk UTSW 16 34,694,409 (GRCm39) missense probably benign 0.20
R1222:Mylk UTSW 16 34,681,022 (GRCm39) missense probably benign 0.12
R1445:Mylk UTSW 16 34,635,835 (GRCm39) missense possibly damaging 0.57
R1583:Mylk UTSW 16 34,695,956 (GRCm39) missense probably benign 0.29
R1618:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1643:Mylk UTSW 16 34,696,005 (GRCm39) missense probably benign 0.03
R1702:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.00
R1776:Mylk UTSW 16 34,773,152 (GRCm39) missense probably benign 0.16
R1865:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.03
R1975:Mylk UTSW 16 34,700,673 (GRCm39) splice site probably null
R2016:Mylk UTSW 16 34,817,187 (GRCm39) missense probably damaging 1.00
R2045:Mylk UTSW 16 34,774,023 (GRCm39) missense probably benign 0.29
R2134:Mylk UTSW 16 34,806,846 (GRCm39) missense probably benign 0.13
R3547:Mylk UTSW 16 34,700,538 (GRCm39) missense possibly damaging 0.61
R3844:Mylk UTSW 16 34,742,247 (GRCm39) missense probably benign 0.01
R4003:Mylk UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
R4396:Mylk UTSW 16 34,732,645 (GRCm39) nonsense probably null
R4470:Mylk UTSW 16 34,732,522 (GRCm39) missense probably benign 0.09
R4507:Mylk UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
R4700:Mylk UTSW 16 34,742,805 (GRCm39) missense probably benign 0.16
R4751:Mylk UTSW 16 34,699,539 (GRCm39) missense probably benign 0.29
R4815:Mylk UTSW 16 34,715,295 (GRCm39) missense probably damaging 0.97
R4832:Mylk UTSW 16 34,742,737 (GRCm39) missense probably benign 0.36
R4872:Mylk UTSW 16 34,735,360 (GRCm39) missense possibly damaging 0.89
R4953:Mylk UTSW 16 34,809,331 (GRCm39) missense probably damaging 1.00
R4969:Mylk UTSW 16 34,791,810 (GRCm39) missense probably damaging 0.96
R5009:Mylk UTSW 16 34,719,877 (GRCm39) missense probably benign 0.39
R5130:Mylk UTSW 16 34,809,367 (GRCm39) missense probably damaging 1.00
R5173:Mylk UTSW 16 34,797,383 (GRCm39) missense probably benign 0.40
R5195:Mylk UTSW 16 34,799,585 (GRCm39) missense probably damaging 1.00
R5209:Mylk UTSW 16 34,742,995 (GRCm39) missense possibly damaging 0.55
R5311:Mylk UTSW 16 34,742,127 (GRCm39) missense probably benign 0.01
R5418:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.02
R5481:Mylk UTSW 16 34,741,974 (GRCm39) missense probably benign 0.09
R5590:Mylk UTSW 16 34,699,722 (GRCm39) missense probably benign 0.29
R5603:Mylk UTSW 16 34,776,862 (GRCm39) missense probably benign 0.06
R5823:Mylk UTSW 16 34,715,317 (GRCm39) critical splice donor site probably null
R6290:Mylk UTSW 16 34,715,213 (GRCm39) missense probably benign 0.39
R6351:Mylk UTSW 16 34,742,341 (GRCm39) missense probably benign 0.01
R6365:Mylk UTSW 16 34,680,961 (GRCm39) missense probably benign 0.12
R6490:Mylk UTSW 16 34,750,237 (GRCm39) missense possibly damaging 0.74
R6723:Mylk UTSW 16 34,750,258 (GRCm39) missense possibly damaging 0.74
R6864:Mylk UTSW 16 34,694,520 (GRCm39) missense probably benign 0.03
R6908:Mylk UTSW 16 34,700,643 (GRCm39) missense probably benign 0.18
R6949:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R7018:Mylk UTSW 16 34,820,796 (GRCm39) missense possibly damaging 0.88
R7035:Mylk UTSW 16 34,797,352 (GRCm39) missense possibly damaging 0.89
R7162:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7236:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7269:Mylk UTSW 16 34,605,381 (GRCm39) missense probably damaging 0.96
R7475:Mylk UTSW 16 34,734,446 (GRCm39) splice site probably null
R7525:Mylk UTSW 16 34,809,357 (GRCm39) missense probably benign 0.06
R7587:Mylk UTSW 16 34,742,887 (GRCm39) missense probably benign 0.29
R7607:Mylk UTSW 16 34,715,184 (GRCm39) missense probably benign 0.09
R7616:Mylk UTSW 16 34,699,927 (GRCm39) missense probably damaging 0.97
R7647:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7648:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7764:Mylk UTSW 16 34,742,553 (GRCm39) missense probably benign 0.16
R7890:Mylk UTSW 16 34,784,018 (GRCm39) nonsense probably null
R7892:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7893:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R8065:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8067:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8143:Mylk UTSW 16 34,734,525 (GRCm39) missense possibly damaging 0.87
R8210:Mylk UTSW 16 34,820,721 (GRCm39) missense probably damaging 1.00
R8271:Mylk UTSW 16 34,742,949 (GRCm39) missense probably damaging 0.97
R8540:Mylk UTSW 16 34,750,257 (GRCm39) missense possibly damaging 0.87
R8721:Mylk UTSW 16 34,817,176 (GRCm39) missense probably damaging 1.00
R8743:Mylk UTSW 16 34,741,427 (GRCm39) missense probably benign 0.03
R8956:Mylk UTSW 16 34,791,779 (GRCm39) missense probably benign 0.01
R9131:Mylk UTSW 16 34,776,835 (GRCm39) missense probably benign 0.29
R9403:Mylk UTSW 16 34,696,012 (GRCm39) nonsense probably null
R9624:Mylk UTSW 16 34,699,677 (GRCm39) missense probably benign 0.29
R9735:Mylk UTSW 16 34,735,179 (GRCm39) missense probably benign 0.09
R9756:Mylk UTSW 16 34,734,387 (GRCm39) missense probably damaging 0.96
R9763:Mylk UTSW 16 34,699,482 (GRCm39) nonsense probably null
RF001:Mylk UTSW 16 34,699,741 (GRCm39) missense probably benign 0.03
V7580:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
V7583:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
X0065:Mylk UTSW 16 34,820,811 (GRCm39) missense probably damaging 1.00
Z1177:Mylk UTSW 16 34,743,021 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- ATGTCTTTCCAGGCCTGCTG -3'
(R):5'- CCAGTTCAGCTCCTTGGATCTG -3'

Sequencing Primer
(F):5'- CAGGCCTGCTGTTGTCC -3'
(R):5'- TTGGATCTGGGCCAGCCATC -3'
Posted On 2021-04-30