Mutagenetix > Incidental Mutation

Incidental Mutation 'R8798:Blnk'

671411

Institutional Source

Beutler Lab

Gene Symbol

Blnk

Ensembl Gene

ENSMUSG00000061132

Gene Name

B cell linker

Synonyms

BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

R8798 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40928927-40994535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40962351 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 119 (Y119H)

Ref Sequence

ENSEMBL: ENSMUSP00000057844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]

AlphaFold

Q9QUN3

PDB Structure

Solution structure of the SH2 domain from mouse B-cell linker protein BLNK [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000054769
AA Change: Y119H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: Y119H

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	345	436	3.07e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117695
AA Change: Y119H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: Y119H

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	342	433	3.07e-19	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	G	A	8: 79,210,751	R176*	probably null	Het
2610044O15Rik8	G	A	8: 129,219,298	H349Y	probably damaging	Het
4921539E11Rik	A	C	4: 103,266,377		probably benign	Het
A430078G23Rik	T	A	8: 3,364,645	Y8N	probably benign	Het
Abcc2	A	G	19: 43,808,666	N492S	probably benign	Het
Acox1	T	C	11: 116,174,357	Y624C	probably damaging	Het
Aff4	T	C	11: 53,400,508		probably benign	Het
Ak9	T	A	10: 41,382,851	D781E		Het
Arfgef3	T	C	10: 18,647,051	D409G	probably damaging	Het
Brsk2	T	C	7: 141,987,864	L310P	probably damaging	Het
Cit	T	A	5: 115,969,043	L1078Q	probably damaging	Het
Cpn1	A	T	19: 43,986,236	V18D	possibly damaging	Het
Csmd3	A	T	15: 47,731,986	Y1115N		Het
Dnah9	A	C	11: 65,905,231	V3589G	probably damaging	Het
Dpp9	T	C	17: 56,199,037	Y454C	probably damaging	Het
Eif3i	A	G	4: 129,596,924	V67A	probably benign	Het
Eif6	T	C	2: 155,822,966	N200S	probably damaging	Het
Fbxo10	T	C	4: 45,051,605	H502R	possibly damaging	Het
Fcer1a	A	G	1: 173,225,480	Y50H	probably benign	Het
Filip1	G	A	9: 79,820,090	H416Y	possibly damaging	Het
Frmpd1	A	T	4: 45,285,424	N1415I	possibly damaging	Het
Gdpgp1	C	T	7: 80,238,977	P252L	probably damaging	Het
Gm340	C	T	19: 41,585,259	R818W	probably damaging	Het
Gsap	T	C	5: 21,271,250		probably null	Het
Hgs	T	C	11: 120,480,112	V598A	probably benign	Het
Irf2	G	T	8: 46,807,314	V94L	probably benign	Het
Kalrn	G	T	16: 33,982,855	H2675Q	possibly damaging	Het
Klhl33	C	A	14: 50,893,108	A50S	possibly damaging	Het
Klk1b11	T	C	7: 43,995,948	I15T	probably benign	Het
Lrrn3	A	G	12: 41,453,175	M381T	possibly damaging	Het
Ltbr	A	G	6: 125,307,295	Y395H	probably benign	Het
Ltf	A	G	9: 111,023,760		probably benign	Het
Ly75	A	G	2: 60,323,926	F1059S	probably benign	Het
Lypd6	T	A	2: 50,188,762	I90N	possibly damaging	Het
Map1a	G	A	2: 121,302,287	V1195M	probably benign	Het
Mb21d1	G	A	9: 78,443,066	R5C	probably benign	Het
Mroh2b	A	T	15: 4,948,709	I1320F	probably damaging	Het
Mug2	A	G	6: 122,081,610	T1324A	probably damaging	Het
Mylk	G	A	16: 34,899,402	V562M	possibly damaging	Het
Myo15b	G	A	11: 115,863,406	G911R		Het
Neo1	A	G	9: 58,913,166	Y825H	probably damaging	Het
Nfat5	T	G	8: 107,347,689	V343G	probably damaging	Het
Nlrp2	A	T	7: 5,327,888	I503K	possibly damaging	Het
Olfr180	A	T	16: 58,915,944	D232E	probably benign	Het
Olfr270	C	A	4: 52,970,790	H56Q	possibly damaging	Het
Olfr924	G	A	9: 38,848,917	E268K	probably benign	Het
Olfr975	G	A	9: 39,950,717	T18I	probably benign	Het
Pdcl2	T	C	5: 76,325,100	D7G	probably damaging	Het
Phyh	C	T	2: 4,919,082	R5C	probably damaging	Het
Prr11	A	C	11: 87,106,055	S28A	unknown	Het
Psmd13	T	A	7: 140,897,750	L190*	probably null	Het
Ptx4	A	G	17: 25,124,742	D322G	probably damaging	Het
Rnf40	T	C	7: 127,589,782	L109P	probably damaging	Het
Rrp1	T	C	10: 78,409,190	T102A	probably damaging	Het
Sema4a	T	G	3: 88,436,697	D749A	possibly damaging	Het
Serpina3f	A	T	12: 104,217,443	D188V	probably benign	Het
Smarca5	C	A	8: 80,716,508	A570S	probably damaging	Het
Spocd1	G	C	4: 129,930,204		probably null	Het
Stard9	G	A	2: 120,704,731	G3823D	probably benign	Het
Suco	A	G	1: 161,820,435	L1094S	probably damaging	Het
Tcf7	T	C	11: 52,260,594	D79G	probably damaging	Het
Tdrd12	A	G	7: 35,529,180	M39T	probably damaging	Het
Thnsl1	A	G	2: 21,212,398	N321S	probably benign	Het
Tmem132c	T	A	5: 127,360,153	Y235*	probably null	Het
Tnfaip6	T	C	2: 52,043,812	F60L	probably benign	Het
Tnpo3	T	C	6: 29,572,621	I411V	probably benign	Het
Trio	A	C	15: 27,851,837	V856G	possibly damaging	Het
Trpc2	C	G	7: 102,084,560	R239G	probably benign	Het
Ttn	C	T	2: 76,826,132	V12502I	unknown	Het
Usf3	A	G	16: 44,220,173	D1672G	probably damaging	Het
Usp24	A	G	4: 106,379,239	N1011S	probably benign	Het
Vac14	A	G	8: 110,719,887	E756G	probably benign	Het
Vmn2r41	A	G	7: 8,161,523	L10P	probably damaging	Het
Xrcc5	T	C	1: 72,314,178	M115T	probably damaging	Het
Zfp827	G	A	8: 79,189,834		probably benign	Het
Zmym1	A	T	4: 127,049,871	N241K	possibly damaging	Het

Other mutations in Blnk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Blnk	APN	19	40934446	missense	probably benign	0.15
IGL01286:Blnk	APN	19	40934506	missense	probably benign	0.00
IGL02090:Blnk	APN	19	40934485	missense	probably benign	0.38
IGL02814:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL02831:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL03024:Blnk	APN	19	40994002	splice site	probably benign
Augen	UTSW	19	40929291	missense	probably damaging	1.00
Blick	UTSW	19	40934459	missense	probably damaging	1.00
busy	UTSW	19	40952391	nonsense	probably null
Buzzy	UTSW	19	40994039	missense	probably benign	0.39
There	UTSW	19	40952390	missense	possibly damaging	0.94
IGL02988:Blnk	UTSW	19	40929216	missense	probably damaging	1.00
R0140:Blnk	UTSW	19	40940224	missense	probably damaging	0.99
R0671:Blnk	UTSW	19	40937667	nonsense	probably null
R1617:Blnk	UTSW	19	40962363	missense	probably benign
R1638:Blnk	UTSW	19	40937678	missense	probably benign
R1803:Blnk	UTSW	19	40952377	missense	probably damaging	0.96
R1970:Blnk	UTSW	19	40940165	splice site	probably benign
R2880:Blnk	UTSW	19	40962455	missense	probably damaging	1.00
R2980:Blnk	UTSW	19	40962350	missense	probably damaging	1.00
R5421:Blnk	UTSW	19	40968523	missense	probably damaging	1.00
R5987:Blnk	UTSW	19	40929289	missense	possibly damaging	0.95
R6321:Blnk	UTSW	19	40934459	missense	probably damaging	1.00
R6703:Blnk	UTSW	19	40962506	splice site	probably null
R6970:Blnk	UTSW	19	40962377	missense	probably damaging	0.99
R7101:Blnk	UTSW	19	40972638	missense	probably benign	0.01
R7432:Blnk	UTSW	19	40959857	nonsense	probably null
R7560:Blnk	UTSW	19	40952390	missense	possibly damaging	0.94
R7797:Blnk	UTSW	19	40959788	missense	possibly damaging	0.51
R8287:Blnk	UTSW	19	40929291	missense	probably damaging	1.00
R8473:Blnk	UTSW	19	40952410	missense	possibly damaging	0.81
R9094:Blnk	UTSW	19	40994039	missense	probably benign	0.39
R9139:Blnk	UTSW	19	40934518	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGGAGAGCAATTCTTAGGGTAC -3'
(R):5'- TAAGGTGGGATCCGCTCACTAG -3'

Sequencing Primer
(F):5'- GTTCAGATAATCTGTTCAATGCTCC -3'
(R):5'- GGATCCGCTCACTAGACAGC -3'

Posted On

2021-04-30