Incidental Mutation 'R8799:Nfx1'
ID 671425
Institutional Source Beutler Lab
Gene Symbol Nfx1
Ensembl Gene ENSMUSG00000028423
Gene Name nuclear transcription factor, X-box binding 1
Synonyms 1300017N15Rik, Tex42, 3000003M19Rik, TEG-42
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock # R8799 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 40970906-41025993 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41023727 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1045 (E1045D)
Ref Sequence ENSEMBL: ENSMUSP00000095747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098143]
AlphaFold B1AY10
Predicted Effect probably damaging
Transcript: ENSMUST00000098143
AA Change: E1045D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423
AA Change: E1045D

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
ZnF_NFX 826 848 7.7e-5 SMART
ZnF_NFX 857 878 4.23e-2 SMART
coiled coil region 930 956 N/A INTRINSIC
R3H 977 1055 1.38e-22 SMART
low complexity region 1070 1088 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,752 C134S probably damaging Het
Acox3 T G 5: 35,589,708 F156L probably damaging Het
Adprhl1 T C 8: 13,222,474 E1428G probably benign Het
Arhgap40 A T 2: 158,512,838 M15L probably benign Het
Bahcc1 C A 11: 120,286,347 F2020L probably damaging Het
BC024063 A T 10: 82,109,518 H324L probably benign Het
Ccdc40 C A 11: 119,264,466 S1177R probably benign Het
Ccne2 A T 4: 11,201,355 R294S probably benign Het
Cib1 A C 7: 80,232,543 S6R probably damaging Het
Csnk2a1 A G 2: 152,257,966 E114G probably damaging Het
Cxxc1 A G 18: 74,221,057 probably benign Het
Decr2 A C 17: 26,088,937 I47M possibly damaging Het
Dmxl2 A G 9: 54,419,743 probably null Het
Dse G A 10: 34,184,153 probably benign Het
Eml6 A G 11: 29,758,981 V1480A probably benign Het
Erap1 A G 13: 74,657,636 I165M probably benign Het
Fan1 G T 7: 64,366,658 Q573K probably damaging Het
Fndc3a G A 14: 72,556,515 T906I probably benign Het
Gm21915 A C 9: 40,670,710 H33P possibly damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Lama3 G T 18: 12,490,943 Q1384H probably damaging Het
Lrrc34 C T 3: 30,624,830 E373K probably benign Het
Ly75 A G 2: 60,348,441 F677L probably damaging Het
Megf11 A G 9: 64,681,391 D493G probably benign Het
Mta3 A T 17: 83,788,940 I348F possibly damaging Het
Myo1d A T 11: 80,684,379 F170L probably damaging Het
Nfkbia A G 12: 55,492,298 probably benign Het
Npffr2 T G 5: 89,583,318 V369G probably benign Het
Olfr1136 G T 2: 87,693,713 H56Q possibly damaging Het
Olfr1312 A T 2: 112,042,183 I283N probably damaging Het
Olfr141 A T 2: 86,806,231 M256K probably damaging Het
Olfr301 T C 7: 86,412,646 C95R probably damaging Het
Olfr984 A T 9: 40,100,689 M267K possibly damaging Het
Otoa G A 7: 121,092,671 E41K possibly damaging Het
Podxl A G 6: 31,524,465 V385A probably damaging Het
Ppp4r4 C T 12: 103,601,364 T673M possibly damaging Het
Rbm20 G T 19: 53,832,689 C525F probably damaging Het
Rnf17 A T 14: 56,500,429 E1222D probably damaging Het
Ros1 G A 10: 52,046,047 A2331V probably benign Het
Rrs1 T A 1: 9,545,594 I24N probably damaging Het
Sec11a A G 7: 80,935,102 V29A possibly damaging Het
Shisa3 T A 5: 67,611,406 Y216* probably null Het
Slc22a2 A T 17: 12,612,538 Y405F probably benign Het
Slc2a12 A T 10: 22,692,206 M511L possibly damaging Het
Slc38a9 T A 13: 112,703,602 H338Q probably damaging Het
Slco1c1 T G 6: 141,559,805 S486A probably benign Het
Slit2 T C 5: 48,304,182 S1524P possibly damaging Het
Spata31d1c T C 13: 65,036,326 S561P possibly damaging Het
Stac3 T A 10: 127,504,912 M182K probably damaging Het
Stt3b T C 9: 115,248,617 E689G probably damaging Het
Suclg1 A G 6: 73,271,108 K271E probably benign Het
Tas1r1 A G 4: 152,032,251 Y309H probably benign Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tbc1d5 TGC TGCGGC 17: 50,799,935 probably benign Het
Tbc1d5 TGC TGCCGC 17: 50,799,941 probably benign Het
Tbc1d5 TG TGCGG 17: 50,799,950 probably benign Het
Tmem101 A G 11: 102,153,510 F184L probably benign Het
Zfp474 A G 18: 52,639,094 Q273R probably benign Het
Zfyve28 A G 5: 34,233,326 L197P probably damaging Het
Other mutations in Nfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Nfx1 APN 4 40977241 missense probably benign 0.00
IGL01998:Nfx1 APN 4 41004353 missense probably damaging 1.00
IGL02072:Nfx1 APN 4 41016119 missense probably benign
IGL02170:Nfx1 APN 4 41018019 missense probably damaging 1.00
IGL02188:Nfx1 APN 4 40993827 missense probably damaging 1.00
IGL02502:Nfx1 APN 4 40976345 splice site probably benign
IGL02674:Nfx1 APN 4 40999717 critical splice donor site probably null
IGL03007:Nfx1 APN 4 40984962 missense probably benign 0.02
IGL03092:Nfx1 APN 4 41024851 missense probably damaging 1.00
IGL03303:Nfx1 APN 4 41004323 splice site probably benign
K7371:Nfx1 UTSW 4 40976803 missense probably damaging 1.00
PIT4498001:Nfx1 UTSW 4 40977244 missense probably benign
R0032:Nfx1 UTSW 4 41015321 missense probably benign 0.00
R0032:Nfx1 UTSW 4 41015321 missense probably benign 0.00
R0069:Nfx1 UTSW 4 40986688 splice site probably benign
R1056:Nfx1 UTSW 4 41003057 missense probably damaging 0.97
R1449:Nfx1 UTSW 4 40976803 missense probably damaging 1.00
R1635:Nfx1 UTSW 4 40977004 missense probably benign
R1636:Nfx1 UTSW 4 41016072 splice site probably null
R1882:Nfx1 UTSW 4 41009240 missense possibly damaging 0.55
R2089:Nfx1 UTSW 4 40977004 missense probably benign
R2091:Nfx1 UTSW 4 40977004 missense probably benign
R2091:Nfx1 UTSW 4 40977004 missense probably benign
R3792:Nfx1 UTSW 4 41004357 nonsense probably null
R3793:Nfx1 UTSW 4 41004357 nonsense probably null
R4668:Nfx1 UTSW 4 40976367 missense possibly damaging 0.50
R4678:Nfx1 UTSW 4 41012070 missense probably benign 0.01
R4894:Nfx1 UTSW 4 40996877 missense probably damaging 1.00
R4972:Nfx1 UTSW 4 40976375 missense probably benign 0.36
R5066:Nfx1 UTSW 4 40991868 missense probably benign
R5389:Nfx1 UTSW 4 40985000 missense probably damaging 1.00
R5429:Nfx1 UTSW 4 41004343 missense probably damaging 1.00
R5643:Nfx1 UTSW 4 40984973 missense probably null 1.00
R5644:Nfx1 UTSW 4 40984973 missense probably null 1.00
R5915:Nfx1 UTSW 4 40977285 missense probably benign 0.02
R6286:Nfx1 UTSW 4 40986728 missense probably damaging 1.00
R6393:Nfx1 UTSW 4 40976851 missense possibly damaging 0.92
R7409:Nfx1 UTSW 4 41021830 missense possibly damaging 0.64
R7523:Nfx1 UTSW 4 41016119 missense probably benign
R7916:Nfx1 UTSW 4 40977142 missense probably benign 0.11
R8497:Nfx1 UTSW 4 40976968 missense possibly damaging 0.67
R9154:Nfx1 UTSW 4 40990845 missense probably damaging 1.00
R9364:Nfx1 UTSW 4 41023756 missense probably benign 0.31
R9497:Nfx1 UTSW 4 40994104 missense probably benign 0.00
X0025:Nfx1 UTSW 4 40976422 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGCTTGTTCTGATCCCAGGG -3'
(R):5'- ACTTGGGTACTAGGGTGCAC -3'

Sequencing Primer
(F):5'- AGGGCATGGAAATGATCAGTCTTCTC -3'
(R):5'- GGTAATGGTAAAAAGGCTATTCCAC -3'
Posted On 2021-04-30