Incidental Mutation 'R8799:Myo1d'
ID671452
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Namemyosin ID
Synonyms9930104H07Rik, D11Ertd9e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8799 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location80482126-80780025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80684379 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 170 (F170L)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
Predicted Effect probably damaging
Transcript: ENSMUST00000041065
AA Change: F170L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: F170L

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070997
AA Change: F170L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: F170L

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,752 C134S probably damaging Het
Acox3 T G 5: 35,589,708 F156L probably damaging Het
Adprhl1 T C 8: 13,222,474 E1428G probably benign Het
Arhgap40 A T 2: 158,512,838 M15L probably benign Het
Bahcc1 C A 11: 120,286,347 F2020L probably damaging Het
BC024063 A T 10: 82,109,518 H324L probably benign Het
Ccdc40 C A 11: 119,264,466 S1177R probably benign Het
Ccne2 A T 4: 11,201,355 R294S probably benign Het
Cib1 A C 7: 80,232,543 S6R probably damaging Het
Csnk2a1 A G 2: 152,257,966 E114G probably damaging Het
Cxxc1 A G 18: 74,221,057 probably benign Het
Decr2 A C 17: 26,088,937 I47M possibly damaging Het
Dmxl2 A G 9: 54,419,743 probably null Het
Dse G A 10: 34,184,153 probably benign Het
Eml6 A G 11: 29,758,981 V1480A probably benign Het
Erap1 A G 13: 74,657,636 I165M probably benign Het
Fan1 G T 7: 64,366,658 Q573K probably damaging Het
Fndc3a G A 14: 72,556,515 T906I probably benign Het
Gm21915 A C 9: 40,670,710 H33P possibly damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Lama3 G T 18: 12,490,943 Q1384H probably damaging Het
Lrrc34 C T 3: 30,624,830 E373K probably benign Het
Ly75 A G 2: 60,348,441 F677L probably damaging Het
Megf11 A G 9: 64,681,391 D493G probably benign Het
Mta3 A T 17: 83,788,940 I348F possibly damaging Het
Nfkbia A G 12: 55,492,298 probably benign Het
Nfx1 A T 4: 41,023,727 E1045D probably damaging Het
Npffr2 T G 5: 89,583,318 V369G probably benign Het
Olfr1136 G T 2: 87,693,713 H56Q possibly damaging Het
Olfr1312 A T 2: 112,042,183 I283N probably damaging Het
Olfr141 A T 2: 86,806,231 M256K probably damaging Het
Olfr301 T C 7: 86,412,646 C95R probably damaging Het
Olfr984 A T 9: 40,100,689 M267K possibly damaging Het
Otoa G A 7: 121,092,671 E41K possibly damaging Het
Podxl A G 6: 31,524,465 V385A probably damaging Het
Ppp4r4 C T 12: 103,601,364 T673M possibly damaging Het
Rbm20 G T 19: 53,832,689 C525F probably damaging Het
Rnf17 A T 14: 56,500,429 E1222D probably damaging Het
Ros1 G A 10: 52,046,047 A2331V probably benign Het
Rrs1 T A 1: 9,545,594 I24N probably damaging Het
Sec11a A G 7: 80,935,102 V29A possibly damaging Het
Shisa3 T A 5: 67,611,406 Y216* probably null Het
Slc22a2 A T 17: 12,612,538 Y405F probably benign Het
Slc2a12 A T 10: 22,692,206 M511L possibly damaging Het
Slc38a9 T A 13: 112,703,602 H338Q probably damaging Het
Slco1c1 T G 6: 141,559,805 S486A probably benign Het
Slit2 T C 5: 48,304,182 S1524P possibly damaging Het
Spata31d1c T C 13: 65,036,326 S561P possibly damaging Het
Stac3 T A 10: 127,504,912 M182K probably damaging Het
Stt3b T C 9: 115,248,617 E689G probably damaging Het
Suclg1 A G 6: 73,271,108 K271E probably benign Het
Tas1r1 A G 4: 152,032,251 Y309H probably benign Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tbc1d5 TGC TGCGGC 17: 50,799,935 probably benign Het
Tbc1d5 TGC TGCCGC 17: 50,799,941 probably benign Het
Tbc1d5 TG TGCGG 17: 50,799,950 probably benign Het
Tmem101 A G 11: 102,153,510 F184L probably benign Het
Zfp474 A G 18: 52,639,094 Q273R probably benign Het
Zfyve28 A G 5: 34,233,326 L197P probably damaging Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R8324:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R8329:Myo1d UTSW 11 80638074 missense probably benign 0.21
R8474:Myo1d UTSW 11 80670919 missense possibly damaging 0.93
R8810:Myo1d UTSW 11 80674932 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80676932 missense probably benign 0.30
R8823:Myo1d UTSW 11 80601745 missense possibly damaging 0.91
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACCTTACCACGGAAGGCAG -3'
(R):5'- TCTTGTCAGTGAACTAGAAACACAG -3'

Sequencing Primer
(F):5'- CGGAAGGCAGACGTGGAGAC -3'
(R):5'- GCTAGGATGACAGTAAGATCATCC -3'
Posted On2021-04-30