Incidental Mutation 'R8801:Fga'
ID671482
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R8801 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83030881 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 188 (A188T)
Ref Sequence ENSEMBL: ENSMUSP00000029630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
AlphaFold E9PV24
Predicted Effect possibly damaging
Transcript: ENSMUST00000029630
AA Change: A188T

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: A188T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166581
AA Change: A188T

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: A188T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik G A 6: 92,831,991 V100I unknown Het
Acta2 G T 19: 34,251,807 Q61K probably damaging Het
Adamts20 T G 15: 94,360,609 D357A probably damaging Het
Adcy4 A G 14: 55,771,995 F798S probably benign Het
Aldh16a1 A G 7: 45,142,014 V779A probably benign Het
Arid1b C A 17: 5,336,828 P1466T probably benign Het
B3gnt2 T C 11: 22,837,002 E62G probably damaging Het
Bcan A C 3: 87,997,275 V58G probably damaging Het
Bhlhe41 T C 6: 145,864,613 Q66R probably damaging Het
Cdh6 G A 15: 13,044,761 T425I probably damaging Het
Csmd2 A G 4: 128,563,402 Y3554C probably damaging Het
Csmd3 T A 15: 48,457,628 H262L possibly damaging Het
Dgcr8 A G 16: 18,280,636 F334S probably damaging Het
Dsg1c A G 18: 20,276,965 T497A probably benign Het
Dsp T C 13: 38,197,526 V2749A possibly damaging Het
Esr1 A G 10: 4,966,270 N486D unknown Het
Fam69c T C 18: 84,739,492 S234P probably benign Het
Fam96b C T 8: 104,640,967 probably null Het
Fbn2 T C 18: 58,153,949 T213A probably damaging Het
Fbxo41 T A 6: 85,484,681 E15V probably damaging Het
Frk C T 10: 34,547,406 S160F possibly damaging Het
Gm13128 A G 4: 144,332,868 Y383C probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gss T C 2: 155,564,766 Y432C probably damaging Het
Ifi27l2b A T 12: 103,457,039 F5I unknown Het
Insm1 T A 2: 146,223,426 Y387* probably null Het
Klf12 T G 14: 100,022,736 I186L probably benign Het
Klrg1 C T 6: 122,271,383 V186I probably benign Het
Loxl3 G T 6: 83,048,648 W329L probably damaging Het
Lyst T A 13: 13,661,010 V1759E probably benign Het
Mlph G A 1: 90,942,887 V507I probably benign Het
Mroh8 G A 2: 157,233,166 T470M probably damaging Het
Nampt T C 12: 32,838,374 Y175H possibly damaging Het
Nedd4l A G 18: 65,155,275 E2G probably damaging Het
Nrxn1 A G 17: 90,701,965 probably benign Het
Olfr1080 A G 2: 86,553,383 V247A probably benign Het
Optc A G 1: 133,905,081 S94P possibly damaging Het
Oxtr T A 6: 112,489,912 probably benign Het
Phip T C 9: 82,876,252 R1463G probably benign Het
Psmc3ip T C 11: 101,093,791 N76S probably benign Het
Reln T A 5: 21,950,856 M2213L possibly damaging Het
Rock1 T C 18: 10,070,260 D1271G probably damaging Het
Rprd1a T G 18: 24,508,223 E112A probably benign Het
Sacm1l A T 9: 123,582,319 D391V probably damaging Het
Serpina3f A T 12: 104,219,478 H314L probably benign Het
Setd5 T A 6: 113,150,892 S1269T possibly damaging Het
Syne1 T C 10: 5,358,335 E740G probably damaging Het
Tcaf1 T A 6: 42,686,808 Q46L probably damaging Het
Tcam1 G A 11: 106,282,792 A21T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Ttll11 A T 2: 35,902,973 L286H probably damaging Het
Usp1 A G 4: 98,934,611 T721A probably benign Het
Vps41 T C 13: 18,814,233 S241P possibly damaging Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0336:Fga UTSW 3 83030857 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2267:Fga UTSW 3 83032950 missense probably damaging 1.00
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2420:Fga UTSW 3 83033154 missense possibly damaging 0.53
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4597:Fga UTSW 3 83031235 nonsense probably null
R4644:Fga UTSW 3 83030266 missense possibly damaging 0.81
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5507:Fga UTSW 3 83033336 missense probably damaging 1.00
R5712:Fga UTSW 3 83033133 missense possibly damaging 0.70
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R6865:Fga UTSW 3 83031541 missense probably damaging 1.00
R7163:Fga UTSW 3 83026264 missense probably benign 0.04
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
R8153:Fga UTSW 3 83030857 missense probably damaging 1.00
R8506:Fga UTSW 3 83033316 missense probably damaging 1.00
R8511:Fga UTSW 3 83031757 nonsense probably null
R8523:Fga UTSW 3 83030851 missense probably damaging 1.00
R8906:Fga UTSW 3 83031804 missense probably benign 0.12
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GACCAGCCTGAGTAGCTAAAGAC -3'
(R):5'- TGGTGAATCTCCTCGCGAAC -3'

Sequencing Primer
(F):5'- ACAAAGGGTAGGATTGATTTTTCTG -3'
(R):5'- ATCTGCCGCATTTCTGTTAATG -3'
Posted On2021-04-30