Incidental Mutation 'R8801:Fbxo41'
ID671491
Institutional Source Beutler Lab
Gene Symbol Fbxo41
Ensembl Gene ENSMUSG00000047013
Gene NameF-box protein 41
SynonymsD6Ertd538e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R8801 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location85469574-85502994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85484681 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 15 (E15V)
Ref Sequence ENSEMBL: ENSMUSP00000125671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546]
Predicted Effect probably damaging
Transcript: ENSMUST00000159062
AA Change: E15V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013
AA Change: E15V

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161078
AA Change: E15V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013
AA Change: E15V

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161546
AA Change: E15V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013
AA Change: E15V

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
Pfam:F-box-like 554 593 5.6e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which is characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one of the four subunits of the SCF ubiquitin protein ligase complex that plays a role in phosphorylation-dependent ubiquitination. F-box proteins are divided into three classes depending on the interaction substrate domain each contains in addition to the F-box motif: FBXW proteins contain WD-40 domains, FBXL proteins contain leucine-rich repeats, and FBXO proteins contain either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the FBXO class. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and premature death by 10 weeks, growth retardation, abnormal gait, dragging hindlimbs, ataxia, impaired balance, impaired coordination, tremors and abnormal neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik G A 6: 92,831,991 V100I unknown Het
Acta2 G T 19: 34,251,807 Q61K probably damaging Het
Adamts20 T G 15: 94,360,609 D357A probably damaging Het
Adcy4 A G 14: 55,771,995 F798S probably benign Het
Aldh16a1 A G 7: 45,142,014 V779A probably benign Het
Arid1b C A 17: 5,336,828 P1466T probably benign Het
B3gnt2 T C 11: 22,837,002 E62G probably damaging Het
Bcan A C 3: 87,997,275 V58G probably damaging Het
Bhlhe41 T C 6: 145,864,613 Q66R probably damaging Het
Cdh6 G A 15: 13,044,761 T425I probably damaging Het
Csmd2 A G 4: 128,563,402 Y3554C probably damaging Het
Csmd3 T A 15: 48,457,628 H262L possibly damaging Het
Dgcr8 A G 16: 18,280,636 F334S probably damaging Het
Dsg1c A G 18: 20,276,965 T497A probably benign Het
Dsp T C 13: 38,197,526 V2749A possibly damaging Het
Esr1 A G 10: 4,966,270 N486D unknown Het
Fam69c T C 18: 84,739,492 S234P probably benign Het
Fam96b C T 8: 104,640,967 probably null Het
Fbn2 T C 18: 58,153,949 T213A probably damaging Het
Fga G A 3: 83,030,881 A188T possibly damaging Het
Frk C T 10: 34,547,406 S160F possibly damaging Het
Gm13128 A G 4: 144,332,868 Y383C probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gss T C 2: 155,564,766 Y432C probably damaging Het
Ifi27l2b A T 12: 103,457,039 F5I unknown Het
Insm1 T A 2: 146,223,426 Y387* probably null Het
Klf12 T G 14: 100,022,736 I186L probably benign Het
Klrg1 C T 6: 122,271,383 V186I probably benign Het
Loxl3 G T 6: 83,048,648 W329L probably damaging Het
Lyst T A 13: 13,661,010 V1759E probably benign Het
Mlph G A 1: 90,942,887 V507I probably benign Het
Mroh8 G A 2: 157,233,166 T470M probably damaging Het
Nampt T C 12: 32,838,374 Y175H possibly damaging Het
Nedd4l A G 18: 65,155,275 E2G probably damaging Het
Nrxn1 A G 17: 90,701,965 probably benign Het
Olfr1080 A G 2: 86,553,383 V247A probably benign Het
Optc A G 1: 133,905,081 S94P possibly damaging Het
Oxtr T A 6: 112,489,912 probably benign Het
Phip T C 9: 82,876,252 R1463G probably benign Het
Psmc3ip T C 11: 101,093,791 N76S probably benign Het
Reln T A 5: 21,950,856 M2213L possibly damaging Het
Rock1 T C 18: 10,070,260 D1271G probably damaging Het
Rprd1a T G 18: 24,508,223 E112A probably benign Het
Sacm1l A T 9: 123,582,319 D391V probably damaging Het
Serpina3f A T 12: 104,219,478 H314L probably benign Het
Setd5 T A 6: 113,150,892 S1269T possibly damaging Het
Syne1 T C 10: 5,358,335 E740G probably damaging Het
Tcaf1 T A 6: 42,686,808 Q46L probably damaging Het
Tcam1 G A 11: 106,282,792 A21T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Ttll11 A T 2: 35,902,973 L286H probably damaging Het
Usp1 A G 4: 98,934,611 T721A probably benign Het
Vps41 T C 13: 18,814,233 S241P possibly damaging Het
Other mutations in Fbxo41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fbxo41 APN 6 85478102 splice site probably null
IGL00919:Fbxo41 APN 6 85478570 missense probably damaging 1.00
IGL01135:Fbxo41 APN 6 85477908 missense probably benign 0.41
IGL02084:Fbxo41 APN 6 85480765 critical splice donor site probably null
IGL02343:Fbxo41 APN 6 85478171 missense possibly damaging 0.78
IGL03284:Fbxo41 APN 6 85479765 missense probably damaging 1.00
R0116:Fbxo41 UTSW 6 85477908 missense probably damaging 1.00
R0452:Fbxo41 UTSW 6 85478182 missense probably damaging 1.00
R2064:Fbxo41 UTSW 6 85478471 nonsense probably null
R2065:Fbxo41 UTSW 6 85478471 nonsense probably null
R2067:Fbxo41 UTSW 6 85478471 nonsense probably null
R3433:Fbxo41 UTSW 6 85477631 missense probably damaging 1.00
R3522:Fbxo41 UTSW 6 85484181 missense probably benign 0.00
R4086:Fbxo41 UTSW 6 85478546 missense possibly damaging 0.93
R4520:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4521:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4522:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4523:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4524:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4867:Fbxo41 UTSW 6 85475194 missense probably benign
R4970:Fbxo41 UTSW 6 85477924 missense probably damaging 1.00
R5000:Fbxo41 UTSW 6 85483919 missense probably damaging 0.98
R5112:Fbxo41 UTSW 6 85477924 missense probably damaging 1.00
R5330:Fbxo41 UTSW 6 85479906 missense probably benign
R5331:Fbxo41 UTSW 6 85479906 missense probably benign
R5334:Fbxo41 UTSW 6 85478483 missense probably damaging 1.00
R5595:Fbxo41 UTSW 6 85479901 missense probably benign 0.00
R5632:Fbxo41 UTSW 6 85484504 missense probably damaging 1.00
R5698:Fbxo41 UTSW 6 85477656 missense possibly damaging 0.88
R5801:Fbxo41 UTSW 6 85484533 missense probably damaging 0.97
R5854:Fbxo41 UTSW 6 85475094 missense probably damaging 1.00
R6258:Fbxo41 UTSW 6 85478555 missense probably damaging 1.00
R6260:Fbxo41 UTSW 6 85478555 missense probably damaging 1.00
R6615:Fbxo41 UTSW 6 85478523 missense possibly damaging 0.60
R7061:Fbxo41 UTSW 6 85475466 missense probably benign 0.36
R7353:Fbxo41 UTSW 6 85479976 missense possibly damaging 0.71
R7681:Fbxo41 UTSW 6 85478479 nonsense probably null
R8077:Fbxo41 UTSW 6 85473229 missense probably damaging 0.98
X0024:Fbxo41 UTSW 6 85478470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGCTCTCAAAGACCTCAC -3'
(R):5'- AGGCTGTTGAGCTTCACTTTC -3'

Sequencing Primer
(F):5'- TCAAAGACCTCACGCCGGG -3'
(R):5'- GTTGAGCTTCACTTTCTTTCTTCTAG -3'
Posted On2021-04-30