Incidental Mutation 'R8802:Abcc6'
ID 671557
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms Mrp6, DCC, Dyscalc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock # R8802 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 45967555-46030302 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46008859 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 451 (L451P)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: L451P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: L451P

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,515,488 T83A possibly damaging Het
Ak5 T C 3: 152,615,994 E252G probably damaging Het
Atg4a-ps T A 3: 103,645,370 K218N probably damaging Het
Bglap2 T A 3: 88,378,261 M35L probably benign Het
Bicral A G 17: 46,824,700 M528T probably benign Het
Cdh23 A G 10: 60,409,098 V1008A probably benign Het
Chil6 A T 3: 106,404,892 L31Q probably damaging Het
Ctnnd2 T C 15: 30,966,876 V991A probably damaging Het
Dcc T C 18: 71,826,054 N216D probably damaging Het
Dcdc2c T A 12: 28,526,721 D106V probably benign Het
Dchs2 T C 3: 83,346,237 I2318T probably benign Het
Fat2 A G 11: 55,282,924 F2321S possibly damaging Het
Fbxw7 T C 3: 84,952,386 V5A unknown Het
Fn3krp T C 11: 121,424,987 V68A probably damaging Het
Gcn1l1 T C 5: 115,609,883 L1783P probably damaging Het
Gdf6 C T 4: 9,844,769 H98Y probably damaging Het
Gm13271 C A 4: 88,755,010 P48Q probably damaging Het
Gm4871 A T 5: 145,030,066 N202K probably benign Het
Gucy1a2 G A 9: 3,635,050 V365I probably benign Het
Hadhb C T 5: 30,173,833 Q157* probably null Het
Hivep2 C T 10: 14,139,422 R1778C probably damaging Het
Hmcn2 T A 2: 31,411,276 V2845E probably damaging Het
Hps3 T A 3: 20,019,906 I431L probably damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Igkv12-38 A T 6: 69,943,406 C43S probably damaging Het
Jph2 T A 2: 163,397,264 H88L probably damaging Het
Kmt2b G A 7: 30,584,071 R955W probably damaging Het
Lrrc4c A G 2: 97,630,258 T410A possibly damaging Het
Ltf C T 9: 111,020,950 P14S probably benign Het
Mapk8ip3 G A 17: 24,905,232 R521C probably damaging Het
Nampt C A 12: 32,850,436 T460K probably benign Het
Nek9 T C 12: 85,327,418 I282V probably benign Het
Ninl A T 2: 150,935,252 V1394E probably damaging Het
Obox6 G A 7: 15,833,847 S225L probably damaging Het
Olfr424 A G 1: 174,137,050 Y102C probably damaging Het
Pcdha4 A G 18: 36,954,158 K465E possibly damaging Het
Pex11g T C 8: 3,457,308 K151R unknown Het
Pld2 T C 11: 70,555,998 L811P probably damaging Het
Pum2 C T 12: 8,728,726 R459* probably null Het
Ralgapa1 T C 12: 55,738,316 S720G probably damaging Het
Rbbp6 T A 7: 122,988,457 probably benign Het
Rbl1 A G 2: 157,196,153 probably null Het
Reln G T 5: 21,925,259 R2685S probably damaging Het
Rnf213 T C 11: 119,462,102 F3942L Het
Rpusd2 T C 2: 119,034,897 V25A probably benign Het
Rusc1 T A 3: 89,092,233 I81L probably benign Het
Serpinb9b A G 13: 33,029,604 E48G probably benign Het
Skil C T 3: 31,113,443 P408L probably damaging Het
Slc17a4 A G 13: 23,905,291 W186R probably damaging Het
Syvn1 T C 19: 6,047,938 F2S probably benign Het
Tmc6 T C 11: 117,775,075 M338V possibly damaging Het
Tnfrsf17 A T 16: 11,319,955 R185S possibly damaging Het
Utp20 T C 10: 88,747,295 K2732R probably damaging Het
Vmn1r58 A T 7: 5,411,081 V50E probably damaging Het
Vmn2r114 T A 17: 23,309,862 D422V possibly damaging Het
Vmn2r83 A T 10: 79,478,427 I170F probably benign Het
Xdh C T 17: 73,918,410 V466I probably benign Het
Xndc1 A G 7: 102,071,332 I6V possibly damaging Het
Zbtb38 T C 9: 96,685,570 T1154A probably benign Het
Zfp160 T A 17: 21,026,605 H472Q probably damaging Het
Zfp438 T A 18: 5,213,417 T514S possibly damaging Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45980025 missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45985145 missense probably benign
R8784:Abcc6 UTSW 7 46002601 missense probably benign
R8807:Abcc6 UTSW 7 45999007 missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 46016396 missense probably benign 0.00
R9127:Abcc6 UTSW 7 45979760 missense probably damaging 1.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCACAGGTCTGGCAACACAG -3'
(R):5'- TAATCATTCAAAAGGAGCAGGGATC -3'

Sequencing Primer
(F):5'- TCTGGCAACACAGGACAAG -3'
(R):5'- GGAGCCGACAAAGTACTTACTTAG -3'
Posted On 2021-04-30