Incidental Mutation 'R8802:Gucy1a2'
ID671560
Institutional Source Beutler Lab
Gene Symbol Gucy1a2
Ensembl Gene ENSMUSG00000041624
Gene Nameguanylate cyclase 1, soluble, alpha 2
Synonyms6330407I18Rik, A230060L24Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R8802 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location3532778-3894736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3635050 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 365 (V365I)
Ref Sequence ENSEMBL: ENSMUSP00000111398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115733]
Predicted Effect probably benign
Transcript: ENSMUST00000115733
AA Change: V365I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111398
Gene: ENSMUSG00000041624
AA Change: V365I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 51 72 N/A INTRINSIC
Pfam:HNOB 121 268 3e-19 PFAM
PDB:4GJ4|D 316 441 1e-17 PDB
CYCc 483 674 6.58e-93 SMART
low complexity region 701 715 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display normal blood vessel and platelet physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,515,488 T83A possibly damaging Het
Abcc6 A G 7: 46,008,859 L451P probably damaging Het
Ak5 T C 3: 152,615,994 E252G probably damaging Het
Atg4a-ps T A 3: 103,645,370 K218N probably damaging Het
Bglap2 T A 3: 88,378,261 M35L probably benign Het
Bicral A G 17: 46,824,700 M528T probably benign Het
Cdh23 A G 10: 60,409,098 V1008A probably benign Het
Chil6 A T 3: 106,404,892 L31Q probably damaging Het
Ctnnd2 T C 15: 30,966,876 V991A probably damaging Het
Dcc T C 18: 71,826,054 N216D probably damaging Het
Dcdc2c T A 12: 28,526,721 D106V probably benign Het
Dchs2 T C 3: 83,346,237 I2318T probably benign Het
Fat2 A G 11: 55,282,924 F2321S possibly damaging Het
Fbxw7 T C 3: 84,952,386 V5A unknown Het
Fn3krp T C 11: 121,424,987 V68A probably damaging Het
Gcn1l1 T C 5: 115,609,883 L1783P probably damaging Het
Gdf6 C T 4: 9,844,769 H98Y probably damaging Het
Gm13271 C A 4: 88,755,010 P48Q probably damaging Het
Gm4871 A T 5: 145,030,066 N202K probably benign Het
Hadhb C T 5: 30,173,833 Q157* probably null Het
Hivep2 C T 10: 14,139,422 R1778C probably damaging Het
Hmcn2 T A 2: 31,411,276 V2845E probably damaging Het
Hps3 T A 3: 20,019,906 I431L probably damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Igkv12-38 A T 6: 69,943,406 C43S probably damaging Het
Jph2 T A 2: 163,397,264 H88L probably damaging Het
Kmt2b G A 7: 30,584,071 R955W probably damaging Het
Lrrc4c A G 2: 97,630,258 T410A possibly damaging Het
Ltf C T 9: 111,020,950 P14S probably benign Het
Mapk8ip3 G A 17: 24,905,232 R521C probably damaging Het
Nampt C A 12: 32,850,436 T460K probably benign Het
Nek9 T C 12: 85,327,418 I282V probably benign Het
Ninl A T 2: 150,935,252 V1394E probably damaging Het
Obox6 G A 7: 15,833,847 S225L probably damaging Het
Olfr424 A G 1: 174,137,050 Y102C probably damaging Het
Pcdha4 A G 18: 36,954,158 K465E possibly damaging Het
Pex11g T C 8: 3,457,308 K151R unknown Het
Pld2 T C 11: 70,555,998 L811P probably damaging Het
Pum2 C T 12: 8,728,726 R459* probably null Het
Ralgapa1 T C 12: 55,738,316 S720G probably damaging Het
Rbl1 A G 2: 157,196,153 probably null Het
Reln G T 5: 21,925,259 R2685S probably damaging Het
Rnf213 T C 11: 119,462,102 F3942L Het
Rpusd2 T C 2: 119,034,897 V25A probably benign Het
Rusc1 T A 3: 89,092,233 I81L probably benign Het
Serpinb9b A G 13: 33,029,604 E48G probably benign Het
Skil C T 3: 31,113,443 P408L probably damaging Het
Slc17a4 A G 13: 23,905,291 W186R probably damaging Het
Syvn1 T C 19: 6,047,938 F2S probably benign Het
Tmc6 T C 11: 117,775,075 M338V possibly damaging Het
Tnfrsf17 A T 16: 11,319,955 R185S possibly damaging Het
Utp20 T C 10: 88,747,295 K2732R probably damaging Het
Vmn1r58 A T 7: 5,411,081 V50E probably damaging Het
Vmn2r114 T A 17: 23,309,862 D422V possibly damaging Het
Vmn2r83 A T 10: 79,478,427 I170F probably benign Het
Xdh C T 17: 73,918,410 V466I probably benign Het
Xndc1 A G 7: 102,071,332 I6V possibly damaging Het
Zbtb38 T C 9: 96,685,570 T1154A probably benign Het
Zfp160 T A 17: 21,026,605 H472Q probably damaging Het
Zfp438 T A 18: 5,213,417 T514S possibly damaging Het
Other mutations in Gucy1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Gucy1a2 APN 9 3759418 missense probably damaging 1.00
IGL00768:Gucy1a2 APN 9 3635111 missense possibly damaging 0.65
IGL00928:Gucy1a2 APN 9 3759777 missense probably damaging 1.00
IGL01520:Gucy1a2 APN 9 3759561 missense probably damaging 0.99
IGL01566:Gucy1a2 APN 9 3634661 missense probably damaging 1.00
IGL01819:Gucy1a2 APN 9 3865409 nonsense probably null
IGL01874:Gucy1a2 APN 9 3797343 missense probably damaging 1.00
IGL02442:Gucy1a2 APN 9 3865385 missense probably damaging 1.00
IGL02608:Gucy1a2 APN 9 3635113 missense probably damaging 0.99
IGL02612:Gucy1a2 APN 9 3894556 missense possibly damaging 0.74
IGL02719:Gucy1a2 APN 9 3894719 utr 3 prime probably benign
IGL02823:Gucy1a2 APN 9 3894656 missense possibly damaging 0.79
IGL02852:Gucy1a2 APN 9 3759691 missense probably benign 0.31
IGL02892:Gucy1a2 APN 9 3634471 missense probably damaging 1.00
IGL02964:Gucy1a2 APN 9 3759542 missense probably damaging 0.96
Rico UTSW 9 3579513 splice site probably null
R0096:Gucy1a2 UTSW 9 3758928 intron probably benign
R0417:Gucy1a2 UTSW 9 3759484 missense possibly damaging 0.80
R0920:Gucy1a2 UTSW 9 3759472 missense probably damaging 1.00
R1146:Gucy1a2 UTSW 9 3759830 missense probably damaging 1.00
R1146:Gucy1a2 UTSW 9 3759830 missense probably damaging 1.00
R1384:Gucy1a2 UTSW 9 3759620 missense probably damaging 1.00
R1631:Gucy1a2 UTSW 9 3533052 missense probably damaging 1.00
R1711:Gucy1a2 UTSW 9 3759622 missense probably benign 0.04
R1730:Gucy1a2 UTSW 9 3634957 missense probably benign 0.36
R1800:Gucy1a2 UTSW 9 3582685 missense possibly damaging 0.62
R2069:Gucy1a2 UTSW 9 3582697 missense probably damaging 1.00
R2166:Gucy1a2 UTSW 9 3579513 splice site probably null
R2357:Gucy1a2 UTSW 9 3797299 missense probably damaging 0.97
R3401:Gucy1a2 UTSW 9 3635154 missense probably benign 0.00
R3953:Gucy1a2 UTSW 9 3582704 splice site probably benign
R4420:Gucy1a2 UTSW 9 3634640 missense probably damaging 1.00
R4731:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4732:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4733:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4931:Gucy1a2 UTSW 9 3759588 missense probably damaging 1.00
R5094:Gucy1a2 UTSW 9 3865443 missense probably damaging 1.00
R5852:Gucy1a2 UTSW 9 3865460 missense probably damaging 0.99
R6005:Gucy1a2 UTSW 9 3865518 splice site probably null
R7667:Gucy1a2 UTSW 9 3759580 missense probably damaging 1.00
R7841:Gucy1a2 UTSW 9 3634766 missense probably benign 0.03
R7866:Gucy1a2 UTSW 9 3532804 start codon destroyed probably null
R8525:Gucy1a2 UTSW 9 3865365 missense probably damaging 1.00
Z1176:Gucy1a2 UTSW 9 3635156 missense probably damaging 1.00
Z1177:Gucy1a2 UTSW 9 3797245 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTTCCCAAGTTCCTGCAG -3'
(R):5'- GGACCAGTAATCTTCTAAATGGTGC -3'

Sequencing Primer
(F):5'- GTTCCTGCAGACCTCAGAATCAG -3'
(R):5'- AAATGGTGCTTAAAACATTCTTGAC -3'
Posted On2021-04-30