Incidental Mutation 'R8802:Xdh'
ID671585
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Namexanthine dehydrogenase
Synonymsxanthine oxidase, XO, Xor, Xox1, Xox-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R8802 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location73883908-73950182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73918410 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 466 (V466I)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: V466I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: V466I

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,515,488 T83A possibly damaging Het
Abcc6 A G 7: 46,008,859 L451P probably damaging Het
Ak5 T C 3: 152,615,994 E252G probably damaging Het
Atg4a-ps T A 3: 103,645,370 K218N probably damaging Het
Bglap2 T A 3: 88,378,261 M35L probably benign Het
Bicral A G 17: 46,824,700 M528T probably benign Het
Cdh23 A G 10: 60,409,098 V1008A probably benign Het
Chil6 A T 3: 106,404,892 L31Q probably damaging Het
Ctnnd2 T C 15: 30,966,876 V991A probably damaging Het
Dcc T C 18: 71,826,054 N216D probably damaging Het
Dcdc2c T A 12: 28,526,721 D106V probably benign Het
Dchs2 T C 3: 83,346,237 I2318T probably benign Het
Fat2 A G 11: 55,282,924 F2321S possibly damaging Het
Fbxw7 T C 3: 84,952,386 V5A unknown Het
Fn3krp T C 11: 121,424,987 V68A probably damaging Het
Gcn1l1 T C 5: 115,609,883 L1783P probably damaging Het
Gdf6 C T 4: 9,844,769 H98Y probably damaging Het
Gm13271 C A 4: 88,755,010 P48Q probably damaging Het
Gm4871 A T 5: 145,030,066 N202K probably benign Het
Gucy1a2 G A 9: 3,635,050 V365I probably benign Het
Hadhb C T 5: 30,173,833 Q157* probably null Het
Hivep2 C T 10: 14,139,422 R1778C probably damaging Het
Hmcn2 T A 2: 31,411,276 V2845E probably damaging Het
Hps3 T A 3: 20,019,906 I431L probably damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Igkv12-38 A T 6: 69,943,406 C43S probably damaging Het
Jph2 T A 2: 163,397,264 H88L probably damaging Het
Kmt2b G A 7: 30,584,071 R955W probably damaging Het
Lrrc4c A G 2: 97,630,258 T410A possibly damaging Het
Ltf C T 9: 111,020,950 P14S probably benign Het
Mapk8ip3 G A 17: 24,905,232 R521C probably damaging Het
Nampt C A 12: 32,850,436 T460K probably benign Het
Nek9 T C 12: 85,327,418 I282V probably benign Het
Ninl A T 2: 150,935,252 V1394E probably damaging Het
Obox6 G A 7: 15,833,847 S225L probably damaging Het
Olfr424 A G 1: 174,137,050 Y102C probably damaging Het
Pcdha4 A G 18: 36,954,158 K465E possibly damaging Het
Pex11g T C 8: 3,457,308 K151R unknown Het
Pld2 T C 11: 70,555,998 L811P probably damaging Het
Pum2 C T 12: 8,728,726 R459* probably null Het
Ralgapa1 T C 12: 55,738,316 S720G probably damaging Het
Rbl1 A G 2: 157,196,153 probably null Het
Reln G T 5: 21,925,259 R2685S probably damaging Het
Rnf213 T C 11: 119,462,102 F3942L Het
Rpusd2 T C 2: 119,034,897 V25A probably benign Het
Rusc1 T A 3: 89,092,233 I81L probably benign Het
Serpinb9b A G 13: 33,029,604 E48G probably benign Het
Skil C T 3: 31,113,443 P408L probably damaging Het
Slc17a4 A G 13: 23,905,291 W186R probably damaging Het
Syvn1 T C 19: 6,047,938 F2S probably benign Het
Tmc6 T C 11: 117,775,075 M338V possibly damaging Het
Tnfrsf17 A T 16: 11,319,955 R185S possibly damaging Het
Utp20 T C 10: 88,747,295 K2732R probably damaging Het
Vmn1r58 A T 7: 5,411,081 V50E probably damaging Het
Vmn2r114 T A 17: 23,309,862 D422V possibly damaging Het
Vmn2r83 A T 10: 79,478,427 I170F probably benign Het
Xndc1 A G 7: 102,071,332 I6V possibly damaging Het
Zbtb38 T C 9: 96,685,570 T1154A probably benign Het
Zfp160 T A 17: 21,026,605 H472Q probably damaging Het
Zfp438 T A 18: 5,213,417 T514S possibly damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8350:Xdh UTSW 17 73934842 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
R8465:Xdh UTSW 17 73899012 nonsense probably null
R8478:Xdh UTSW 17 73906058 missense probably benign 0.00
R8680:Xdh UTSW 17 73922505 missense probably benign
R8984:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8985:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8995:Xdh UTSW 17 73898374 missense probably damaging 1.00
R9035:Xdh UTSW 17 73910227 missense probably benign
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAGCCAAACTGAATAGCC -3'
(R):5'- ACAGACCTGTGTTTCATGCAG -3'

Sequencing Primer
(F):5'- CTGTGAGACCAGGCAATGAC -3'
(R):5'- CTGTGTTTCATGCAGGCTATTTTC -3'
Posted On2021-04-30