Incidental Mutation 'R8803:Crygf'
ID 671590
Institutional Source Beutler Lab
Gene Symbol Crygf
Ensembl Gene ENSMUSG00000025945
Gene Name crystallin, gamma F
Synonyms Len-2, DGcry-2, Cryg-2, 3110001K11Rik
MMRRC Submission 068640-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.448) question?
Stock # R8803 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 65965679-65967466 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65967148 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 91 (R91G)
Ref Sequence ENSEMBL: ENSMUSP00000027082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027082] [ENSMUST00000114027]
AlphaFold Q9CXV3
Predicted Effect probably damaging
Transcript: ENSMUST00000027082
AA Change: R91G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027082
Gene: ENSMUSG00000025945
AA Change: R91G

DomainStartEndE-ValueType
XTALbg 3 82 1.11e-43 SMART
XTALbg 89 170 2.19e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114027
AA Change: Q86R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109661
Gene: ENSMUSG00000025945
AA Change: Q86R

DomainStartEndE-ValueType
XTALbg 3 82 1.11e-43 SMART
low complexity region 104 113 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically-induced single point mutation exhibit homogeneous cataracts while heterozygotes display less severe rays and concentric circles of lens opacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,998,290 (GRCm39) S431T probably benign Het
Acot7 T G 4: 152,302,272 (GRCm39) V128G probably damaging Het
Actn3 T C 19: 4,914,691 (GRCm39) D508G probably benign Het
Adam18 T C 8: 25,137,878 (GRCm39) I321V probably benign Het
Ak1 T C 2: 32,523,490 (GRCm39) V186A probably benign Het
Aldh3a2 A G 11: 61,139,756 (GRCm39) F459L probably benign Het
Atp11a T C 8: 12,875,721 (GRCm39) L256P probably benign Het
Bcan T C 3: 87,903,999 (GRCm39) E162G probably benign Het
Birc6 A G 17: 74,959,033 (GRCm39) Q3850R probably damaging Het
Btf3l4 T G 4: 108,689,084 (GRCm39) probably benign Het
Btla A G 16: 45,059,430 (GRCm39) T45A probably benign Het
Cad T G 5: 31,226,908 (GRCm39) S1222A probably damaging Het
Cbarp A G 10: 79,972,976 (GRCm39) V39A possibly damaging Het
Cct2 A C 10: 116,894,090 (GRCm39) D221E probably benign Het
Cmya5 T C 13: 93,177,991 (GRCm39) D3621G probably damaging Het
Col20a1 G T 2: 180,643,131 (GRCm39) R867L possibly damaging Het
Cops3 A G 11: 59,718,802 (GRCm39) V164A probably benign Het
Csmd2 T A 4: 128,440,477 (GRCm39) S3181T Het
Cyb5r1 G T 1: 134,333,696 (GRCm39) probably benign Het
Dennd6b T A 15: 89,070,383 (GRCm39) I429F probably benign Het
Dock1 A G 7: 134,475,816 (GRCm39) T864A probably benign Het
Eea1 A T 10: 95,859,853 (GRCm39) D713V probably benign Het
Fam78b G A 1: 166,829,160 (GRCm39) C9Y probably damaging Het
Gga2 A C 7: 121,597,002 (GRCm39) D371E probably benign Het
Gtpbp6 A T 5: 110,255,186 (GRCm39) V2E unknown Het
Hectd4 A T 5: 121,461,994 (GRCm39) M954L probably benign Het
Hmcn1 A G 1: 150,610,248 (GRCm39) C1474R probably damaging Het
Igkv1-99 G T 6: 68,519,370 (GRCm39) G109V Het
Izumo3 T C 4: 92,033,310 (GRCm39) probably null Het
Kremen1 T C 11: 5,144,981 (GRCm39) D465G probably benign Het
Ksr1 T C 11: 79,036,882 (GRCm39) E75G probably benign Het
Mmp17 G T 5: 129,675,773 (GRCm39) E311* probably null Het
Mmrn1 T A 6: 60,965,271 (GRCm39) F1101I probably damaging Het
Muc13 G A 16: 33,633,287 (GRCm39) probably benign Het
Myl4 T A 11: 104,475,403 (GRCm39) M147K probably damaging Het
Myo1a T A 10: 127,546,856 (GRCm39) N334K probably benign Het
Myo3b T C 2: 70,083,338 (GRCm39) S664P probably benign Het
Nptxr T C 15: 79,678,655 (GRCm39) N211D probably damaging Het
Ntf5 A G 7: 45,065,485 (GRCm39) T206A probably benign Het
Obscn T A 11: 58,945,229 (GRCm39) E4596D probably benign Het
Or4d10c T C 19: 12,065,469 (GRCm39) E229G probably benign Het
Or4f14d T C 2: 111,960,427 (GRCm39) H243R probably damaging Het
Or5ak20 T A 2: 85,184,078 (GRCm39) Q64L probably damaging Het
Or5ak25 T A 2: 85,268,981 (GRCm39) I174F probably damaging Het
Or5b3 A T 19: 13,388,037 (GRCm39) I35F probably damaging Het
Or7e169 A T 9: 19,757,462 (GRCm39) I151N possibly damaging Het
Paip2 A G 18: 35,749,273 (GRCm39) N114D possibly damaging Het
Pcnx1 T C 12: 82,039,925 (GRCm39) S2071P possibly damaging Het
Pcsk2 A G 2: 143,637,870 (GRCm39) T369A probably damaging Het
Ppp1r12b A C 1: 134,818,492 (GRCm39) probably benign Het
Ppp1r35 T A 5: 137,777,731 (GRCm39) D132E possibly damaging Het
Pramel7 A T 2: 87,320,405 (GRCm39) V296E probably benign Het
Prh1 C T 6: 132,548,948 (GRCm39) P152S unknown Het
Pygl T C 12: 70,242,390 (GRCm39) T689A probably damaging Het
Rasgef1b T C 5: 99,369,269 (GRCm39) S450G probably benign Het
Rtn4ip1 G T 10: 43,783,842 (GRCm39) R121L probably damaging Het
Scarf2 A T 16: 17,620,695 (GRCm39) H121L probably damaging Het
Selenbp1 C A 3: 94,851,821 (GRCm39) A454E possibly damaging Het
Slc7a9 A G 7: 35,163,143 (GRCm39) I449M possibly damaging Het
Snapc2 C T 8: 4,305,558 (GRCm39) H278Y probably damaging Het
Stambp C T 6: 83,524,212 (GRCm39) probably null Het
Syne1 T C 10: 5,311,535 (GRCm39) Y550C probably damaging Het
Tas2r113 T C 6: 132,870,104 (GRCm39) V44A possibly damaging Het
Trpv4 T C 5: 114,772,816 (GRCm39) T305A probably benign Het
Twf1 T C 15: 94,479,136 (GRCm39) Y241C probably damaging Het
Ugt2a3 T C 5: 87,484,389 (GRCm39) K212E probably damaging Het
Ush2a A T 1: 188,676,998 (GRCm39) H4770L probably benign Het
Zfc3h1 T C 10: 115,247,800 (GRCm39) V1001A probably benign Het
Zfp335 C T 2: 164,751,290 (GRCm39) R92Q probably benign Het
Other mutations in Crygf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03280:Crygf APN 1 65,967,329 (GRCm39) missense probably damaging 1.00
R0632:Crygf UTSW 1 65,967,156 (GRCm39) nonsense probably null
R1514:Crygf UTSW 1 65,967,197 (GRCm39) missense possibly damaging 0.53
R2312:Crygf UTSW 1 65,965,717 (GRCm39) start codon destroyed probably benign 0.00
R6541:Crygf UTSW 1 65,967,224 (GRCm39) missense probably damaging 0.99
R7018:Crygf UTSW 1 65,967,130 (GRCm39) missense probably benign 0.00
X0023:Crygf UTSW 1 65,965,924 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGTTGTGTGACTCGAAC -3'
(R):5'- AATCGTGGTAGCGCCTATACTC -3'

Sequencing Primer
(F):5'- GACTCGAACTTTGGCAGAATTTCCAC -3'
(R):5'- GGTAGCGCCTATACTCCCCTG -3'
Posted On 2021-04-30