Incidental Mutation 'R8803:Ush2a'
ID 671595
Institutional Source Beutler Lab
Gene Symbol Ush2a
Ensembl Gene ENSMUSG00000026609
Gene Name usherin
Synonyms MUSH2A, LOC269160, LOC381317, Ushrn, Ush2a, A930037M10Rik, A930011D15Rik
MMRRC Submission 068640-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.501) question?
Stock # R8803 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 187995035-188697694 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 188676998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 4770 (H4770L)
Ref Sequence ENSEMBL: ENSMUSP00000050454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060479]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000060479
AA Change: H4770L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050454
Gene: ENSMUSG00000026609
AA Change: H4770L

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Laminin_G_3 128 283 6.5e-16 PFAM
LamNT 310 513 6.79e-9 SMART
EGF_Lam 515 569 1.58e-3 SMART
EGF_Lam 572 635 5.69e-10 SMART
EGF_Lam 638 688 4.38e-11 SMART
EGF_Lam 691 741 3.56e-11 SMART
EGF_Lam 744 789 7.93e-9 SMART
EGF_Lam 792 841 3.37e-12 SMART
EGF_Lam 844 894 2.01e-10 SMART
EGF_Lam 897 945 5.43e-16 SMART
EGF_Lam 948 996 7.88e-4 SMART
EGF_Lam 999 1047 2.96e-8 SMART
FN3 1051 1130 1e-1 SMART
FN3 1145 1224 2.06e-3 SMART
FN3 1239 1342 8.69e-11 SMART
FN3 1356 1447 5.32e-6 SMART
FN3 1461 1570 2.63e1 SMART
LamG 1531 1672 5.39e-19 SMART
LamG 1727 1862 2.33e-23 SMART
FN3 1861 1931 9.15e1 SMART
FN3 1945 2032 2.24e-4 SMART
FN3 2047 2120 1.13e0 SMART
FN3 2134 2218 3.4e-4 SMART
FN3 2232 2306 1.59e-4 SMART
FN3 2320 2412 1.12e-4 SMART
FN3 2423 2510 8.9e-8 SMART
FN3 2524 2600 1.95e-4 SMART
FN3 2612 2701 4.67e-2 SMART
FN3 2715 2792 1.17e-7 SMART
FN3 2809 2902 1.12e-4 SMART
FN3 2913 2997 5.36e-2 SMART
FN3 3011 3089 2.46e-1 SMART
FN3 3101 3477 2.85e1 SMART
FN3 3491 3568 4e-1 SMART
FN3 3582 3659 5.87e-8 SMART
FN3 3673 3750 1.75e-6 SMART
FN3 3764 3845 9.62e-4 SMART
FN3 3859 3943 2.41e-4 SMART
FN3 3954 4044 5.11e-8 SMART
FN3 4058 4133 1.06e0 SMART
FN3 4147 4241 7.87e-9 SMART
FN3 4255 4334 1.15e-1 SMART
FN3 4348 4422 6.39e-9 SMART
FN3 4435 4510 6.91e-5 SMART
FN3 4521 4610 2.28e-5 SMART
FN3 4626 4713 1.71e0 SMART
FN3 4724 4805 1.3e0 SMART
FN3 4817 4909 3.62e-8 SMART
transmembrane domain 5032 5054 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display progressive retinal photoreceptor degeneration along with significantly reduced a- and b-wave amplitudes, and a moderate but nonprogressive high-frequency hearing loss associated with widespread loss of outer hair cells in the basal turn of the cochlea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,998,290 (GRCm39) S431T probably benign Het
Acot7 T G 4: 152,302,272 (GRCm39) V128G probably damaging Het
Actn3 T C 19: 4,914,691 (GRCm39) D508G probably benign Het
Adam18 T C 8: 25,137,878 (GRCm39) I321V probably benign Het
Ak1 T C 2: 32,523,490 (GRCm39) V186A probably benign Het
Aldh3a2 A G 11: 61,139,756 (GRCm39) F459L probably benign Het
Atp11a T C 8: 12,875,721 (GRCm39) L256P probably benign Het
Bcan T C 3: 87,903,999 (GRCm39) E162G probably benign Het
Birc6 A G 17: 74,959,033 (GRCm39) Q3850R probably damaging Het
Btf3l4 T G 4: 108,689,084 (GRCm39) probably benign Het
Btla A G 16: 45,059,430 (GRCm39) T45A probably benign Het
Cad T G 5: 31,226,908 (GRCm39) S1222A probably damaging Het
Cbarp A G 10: 79,972,976 (GRCm39) V39A possibly damaging Het
Cct2 A C 10: 116,894,090 (GRCm39) D221E probably benign Het
Cmya5 T C 13: 93,177,991 (GRCm39) D3621G probably damaging Het
Col20a1 G T 2: 180,643,131 (GRCm39) R867L possibly damaging Het
Cops3 A G 11: 59,718,802 (GRCm39) V164A probably benign Het
Crygf A G 1: 65,967,148 (GRCm39) R91G probably damaging Het
Csmd2 T A 4: 128,440,477 (GRCm39) S3181T Het
Cyb5r1 G T 1: 134,333,696 (GRCm39) probably benign Het
Dennd6b T A 15: 89,070,383 (GRCm39) I429F probably benign Het
Dock1 A G 7: 134,475,816 (GRCm39) T864A probably benign Het
Eea1 A T 10: 95,859,853 (GRCm39) D713V probably benign Het
Fam78b G A 1: 166,829,160 (GRCm39) C9Y probably damaging Het
Gga2 A C 7: 121,597,002 (GRCm39) D371E probably benign Het
Gtpbp6 A T 5: 110,255,186 (GRCm39) V2E unknown Het
Hectd4 A T 5: 121,461,994 (GRCm39) M954L probably benign Het
Hmcn1 A G 1: 150,610,248 (GRCm39) C1474R probably damaging Het
Igkv1-99 G T 6: 68,519,370 (GRCm39) G109V Het
Izumo3 T C 4: 92,033,310 (GRCm39) probably null Het
Kremen1 T C 11: 5,144,981 (GRCm39) D465G probably benign Het
Ksr1 T C 11: 79,036,882 (GRCm39) E75G probably benign Het
Mmp17 G T 5: 129,675,773 (GRCm39) E311* probably null Het
Mmrn1 T A 6: 60,965,271 (GRCm39) F1101I probably damaging Het
Muc13 G A 16: 33,633,287 (GRCm39) probably benign Het
Myl4 T A 11: 104,475,403 (GRCm39) M147K probably damaging Het
Myo1a T A 10: 127,546,856 (GRCm39) N334K probably benign Het
Myo3b T C 2: 70,083,338 (GRCm39) S664P probably benign Het
Nptxr T C 15: 79,678,655 (GRCm39) N211D probably damaging Het
Ntf5 A G 7: 45,065,485 (GRCm39) T206A probably benign Het
Obscn T A 11: 58,945,229 (GRCm39) E4596D probably benign Het
Or4d10c T C 19: 12,065,469 (GRCm39) E229G probably benign Het
Or4f14d T C 2: 111,960,427 (GRCm39) H243R probably damaging Het
Or5ak20 T A 2: 85,184,078 (GRCm39) Q64L probably damaging Het
Or5ak25 T A 2: 85,268,981 (GRCm39) I174F probably damaging Het
Or5b3 A T 19: 13,388,037 (GRCm39) I35F probably damaging Het
Or7e169 A T 9: 19,757,462 (GRCm39) I151N possibly damaging Het
Paip2 A G 18: 35,749,273 (GRCm39) N114D possibly damaging Het
Pcnx1 T C 12: 82,039,925 (GRCm39) S2071P possibly damaging Het
Pcsk2 A G 2: 143,637,870 (GRCm39) T369A probably damaging Het
Ppp1r12b A C 1: 134,818,492 (GRCm39) probably benign Het
Ppp1r35 T A 5: 137,777,731 (GRCm39) D132E possibly damaging Het
Pramel7 A T 2: 87,320,405 (GRCm39) V296E probably benign Het
Prh1 C T 6: 132,548,948 (GRCm39) P152S unknown Het
Pygl T C 12: 70,242,390 (GRCm39) T689A probably damaging Het
Rasgef1b T C 5: 99,369,269 (GRCm39) S450G probably benign Het
Rtn4ip1 G T 10: 43,783,842 (GRCm39) R121L probably damaging Het
Scarf2 A T 16: 17,620,695 (GRCm39) H121L probably damaging Het
Selenbp1 C A 3: 94,851,821 (GRCm39) A454E possibly damaging Het
Slc7a9 A G 7: 35,163,143 (GRCm39) I449M possibly damaging Het
Snapc2 C T 8: 4,305,558 (GRCm39) H278Y probably damaging Het
Stambp C T 6: 83,524,212 (GRCm39) probably null Het
Syne1 T C 10: 5,311,535 (GRCm39) Y550C probably damaging Het
Tas2r113 T C 6: 132,870,104 (GRCm39) V44A possibly damaging Het
Trpv4 T C 5: 114,772,816 (GRCm39) T305A probably benign Het
Twf1 T C 15: 94,479,136 (GRCm39) Y241C probably damaging Het
Ugt2a3 T C 5: 87,484,389 (GRCm39) K212E probably damaging Het
Zfc3h1 T C 10: 115,247,800 (GRCm39) V1001A probably benign Het
Zfp335 C T 2: 164,751,290 (GRCm39) R92Q probably benign Het
Other mutations in Ush2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ush2a APN 1 188,596,875 (GRCm39) missense probably benign 0.00
IGL00391:Ush2a APN 1 188,648,258 (GRCm39) missense probably damaging 1.00
IGL00429:Ush2a APN 1 188,132,311 (GRCm39) nonsense probably null
IGL00484:Ush2a APN 1 188,514,710 (GRCm39) missense probably benign 0.00
IGL00519:Ush2a APN 1 188,176,865 (GRCm39) missense probably benign 0.03
IGL00567:Ush2a APN 1 188,697,114 (GRCm39) missense probably damaging 1.00
IGL00823:Ush2a APN 1 188,643,640 (GRCm39) missense possibly damaging 0.61
IGL00940:Ush2a APN 1 188,090,158 (GRCm39) nonsense probably null
IGL00951:Ush2a APN 1 187,995,662 (GRCm39) missense probably benign 0.33
IGL00956:Ush2a APN 1 188,485,719 (GRCm39) missense probably damaging 0.99
IGL01096:Ush2a APN 1 188,410,574 (GRCm39) missense probably damaging 1.00
IGL01108:Ush2a APN 1 188,595,022 (GRCm39) missense probably benign 0.00
IGL01315:Ush2a APN 1 188,365,811 (GRCm39) missense possibly damaging 0.51
IGL01318:Ush2a APN 1 188,546,550 (GRCm39) missense probably benign 0.00
IGL01324:Ush2a APN 1 188,581,189 (GRCm39) missense probably benign 0.38
IGL01326:Ush2a APN 1 187,995,518 (GRCm39) nonsense probably null
IGL01384:Ush2a APN 1 188,285,425 (GRCm39) missense possibly damaging 0.65
IGL01466:Ush2a APN 1 188,643,819 (GRCm39) missense probably benign 0.00
IGL01518:Ush2a APN 1 188,131,982 (GRCm39) missense probably benign 0.01
IGL01585:Ush2a APN 1 188,162,924 (GRCm39) missense probably damaging 1.00
IGL01595:Ush2a APN 1 188,386,921 (GRCm39) critical splice donor site probably null
IGL01657:Ush2a APN 1 188,558,658 (GRCm39) missense probably benign 0.03
IGL01797:Ush2a APN 1 187,995,706 (GRCm39) missense probably damaging 1.00
IGL01802:Ush2a APN 1 188,169,154 (GRCm39) missense probably damaging 0.99
IGL01836:Ush2a APN 1 188,492,060 (GRCm39) splice site probably benign
IGL01938:Ush2a APN 1 188,530,042 (GRCm39) missense probably damaging 1.00
IGL01976:Ush2a APN 1 188,643,438 (GRCm39) missense probably benign 0.04
IGL02023:Ush2a APN 1 188,465,711 (GRCm39) missense probably benign 0.03
IGL02126:Ush2a APN 1 187,995,588 (GRCm39) missense probably benign 0.01
IGL02133:Ush2a APN 1 188,175,540 (GRCm39) missense probably damaging 1.00
IGL02147:Ush2a APN 1 188,596,900 (GRCm39) missense probably benign
IGL02275:Ush2a APN 1 187,995,466 (GRCm39) missense possibly damaging 0.67
IGL02314:Ush2a APN 1 188,365,826 (GRCm39) missense probably benign 0.00
IGL02353:Ush2a APN 1 188,460,635 (GRCm39) missense probably benign 0.04
IGL02360:Ush2a APN 1 188,460,635 (GRCm39) missense probably benign 0.04
IGL02367:Ush2a APN 1 188,516,943 (GRCm39) missense probably benign
IGL02402:Ush2a APN 1 187,999,305 (GRCm39) missense probably benign 0.02
IGL02410:Ush2a APN 1 188,648,194 (GRCm39) missense probably damaging 1.00
IGL02490:Ush2a APN 1 188,542,561 (GRCm39) missense probably damaging 1.00
IGL02500:Ush2a APN 1 188,554,893 (GRCm39) missense probably damaging 1.00
IGL02511:Ush2a APN 1 188,475,884 (GRCm39) critical splice donor site probably null
IGL02517:Ush2a APN 1 188,648,195 (GRCm39) missense probably damaging 1.00
IGL02536:Ush2a APN 1 188,689,463 (GRCm39) critical splice acceptor site probably null
IGL02585:Ush2a APN 1 188,460,530 (GRCm39) missense probably benign 0.00
IGL02610:Ush2a APN 1 188,176,663 (GRCm39) missense probably damaging 0.98
IGL02677:Ush2a APN 1 188,466,882 (GRCm39) missense probably damaging 1.00
IGL02691:Ush2a APN 1 188,466,949 (GRCm39) missense probably damaging 1.00
IGL02740:Ush2a APN 1 188,380,585 (GRCm39) missense possibly damaging 0.68
IGL02744:Ush2a APN 1 188,090,914 (GRCm39) splice site probably null
IGL02749:Ush2a APN 1 188,679,155 (GRCm39) missense probably damaging 0.99
IGL02806:Ush2a APN 1 188,542,554 (GRCm39) nonsense probably null
IGL02870:Ush2a APN 1 188,410,555 (GRCm39) missense probably benign 0.42
IGL02894:Ush2a APN 1 188,184,043 (GRCm39) missense probably damaging 1.00
IGL02904:Ush2a APN 1 188,638,703 (GRCm39) missense probably benign 0.06
IGL03000:Ush2a APN 1 188,282,053 (GRCm39) missense possibly damaging 0.81
IGL03015:Ush2a APN 1 188,169,147 (GRCm39) missense probably benign 0.01
IGL03036:Ush2a APN 1 188,596,818 (GRCm39) missense possibly damaging 0.80
IGL03057:Ush2a APN 1 188,530,035 (GRCm39) missense probably damaging 1.00
IGL03230:Ush2a APN 1 188,198,390 (GRCm39) missense probably benign 0.09
IGL03278:Ush2a APN 1 188,581,313 (GRCm39) missense probably damaging 1.00
BB003:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
BB013:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
PIT4283001:Ush2a UTSW 1 188,169,064 (GRCm39) missense probably benign 0.01
R0003:Ush2a UTSW 1 188,310,688 (GRCm39) missense probably damaging 0.99
R0030:Ush2a UTSW 1 188,554,854 (GRCm39) missense possibly damaging 0.51
R0035:Ush2a UTSW 1 188,089,085 (GRCm39) missense probably benign
R0038:Ush2a UTSW 1 188,358,809 (GRCm39) missense probably benign 0.00
R0038:Ush2a UTSW 1 188,358,809 (GRCm39) missense probably benign 0.00
R0067:Ush2a UTSW 1 188,697,043 (GRCm39) missense probably damaging 0.99
R0067:Ush2a UTSW 1 188,697,043 (GRCm39) missense probably damaging 0.99
R0103:Ush2a UTSW 1 188,051,267 (GRCm39) missense possibly damaging 0.81
R0103:Ush2a UTSW 1 188,051,267 (GRCm39) missense possibly damaging 0.81
R0122:Ush2a UTSW 1 188,680,652 (GRCm39) missense possibly damaging 0.65
R0206:Ush2a UTSW 1 188,263,958 (GRCm39) missense probably damaging 0.99
R0208:Ush2a UTSW 1 188,263,958 (GRCm39) missense probably damaging 0.99
R0230:Ush2a UTSW 1 188,582,301 (GRCm39) missense probably damaging 1.00
R0269:Ush2a UTSW 1 188,542,373 (GRCm39) missense probably benign 0.33
R0319:Ush2a UTSW 1 188,680,571 (GRCm39) splice site probably benign
R0358:Ush2a UTSW 1 188,269,977 (GRCm39) missense possibly damaging 0.83
R0379:Ush2a UTSW 1 188,184,016 (GRCm39) missense probably damaging 1.00
R0427:Ush2a UTSW 1 188,132,478 (GRCm39) missense probably damaging 1.00
R0437:Ush2a UTSW 1 188,643,228 (GRCm39) missense probably benign 0.00
R0462:Ush2a UTSW 1 188,643,136 (GRCm39) missense probably benign
R0510:Ush2a UTSW 1 188,466,860 (GRCm39) splice site probably benign
R0531:Ush2a UTSW 1 188,175,378 (GRCm39) missense probably benign 0.18
R0541:Ush2a UTSW 1 188,446,663 (GRCm39) splice site probably benign
R0549:Ush2a UTSW 1 188,679,150 (GRCm39) missense probably damaging 0.99
R0562:Ush2a UTSW 1 188,089,044 (GRCm39) missense probably damaging 1.00
R0636:Ush2a UTSW 1 188,554,935 (GRCm39) missense probably benign
R0662:Ush2a UTSW 1 188,083,290 (GRCm39) missense probably benign 0.26
R0685:Ush2a UTSW 1 188,132,475 (GRCm39) missense probably damaging 1.00
R0718:Ush2a UTSW 1 188,530,027 (GRCm39) missense probably damaging 1.00
R0725:Ush2a UTSW 1 188,683,722 (GRCm39) missense probably damaging 1.00
R0735:Ush2a UTSW 1 188,596,890 (GRCm39) missense probably benign 0.04
R0744:Ush2a UTSW 1 188,546,603 (GRCm39) splice site probably benign
R0765:Ush2a UTSW 1 188,680,771 (GRCm39) missense possibly damaging 0.67
R0862:Ush2a UTSW 1 188,275,015 (GRCm39) nonsense probably null
R1067:Ush2a UTSW 1 188,282,404 (GRCm39) missense probably benign 0.35
R1072:Ush2a UTSW 1 188,460,914 (GRCm39) missense possibly damaging 0.91
R1099:Ush2a UTSW 1 188,596,836 (GRCm39) missense probably damaging 1.00
R1099:Ush2a UTSW 1 188,380,545 (GRCm39) missense probably benign 0.06
R1104:Ush2a UTSW 1 188,648,453 (GRCm39) missense probably benign
R1106:Ush2a UTSW 1 188,643,180 (GRCm39) missense possibly damaging 0.82
R1124:Ush2a UTSW 1 188,485,733 (GRCm39) missense probably damaging 0.99
R1168:Ush2a UTSW 1 188,410,608 (GRCm39) missense probably benign 0.01
R1199:Ush2a UTSW 1 188,491,992 (GRCm39) missense probably benign 0.00
R1215:Ush2a UTSW 1 188,689,479 (GRCm39) missense possibly damaging 0.66
R1307:Ush2a UTSW 1 188,184,037 (GRCm39) missense probably damaging 1.00
R1307:Ush2a UTSW 1 188,090,164 (GRCm39) missense probably damaging 1.00
R1311:Ush2a UTSW 1 188,679,342 (GRCm39) missense possibly damaging 0.86
R1388:Ush2a UTSW 1 188,255,515 (GRCm39) splice site probably benign
R1416:Ush2a UTSW 1 188,169,080 (GRCm39) missense probably damaging 1.00
R1424:Ush2a UTSW 1 188,275,075 (GRCm39) critical splice donor site probably null
R1459:Ush2a UTSW 1 188,595,048 (GRCm39) missense probably benign 0.05
R1470:Ush2a UTSW 1 188,132,403 (GRCm39) missense probably benign 0.00
R1470:Ush2a UTSW 1 188,132,403 (GRCm39) missense probably benign 0.00
R1477:Ush2a UTSW 1 188,581,273 (GRCm39) missense probably benign 0.05
R1484:Ush2a UTSW 1 188,542,534 (GRCm39) nonsense probably null
R1490:Ush2a UTSW 1 188,092,038 (GRCm39) missense probably benign 0.24
R1510:Ush2a UTSW 1 188,380,501 (GRCm39) missense probably damaging 1.00
R1522:Ush2a UTSW 1 188,530,011 (GRCm39) missense possibly damaging 0.94
R1606:Ush2a UTSW 1 188,491,963 (GRCm39) missense probably benign 0.17
R1618:Ush2a UTSW 1 188,546,421 (GRCm39) missense probably benign 0.29
R1636:Ush2a UTSW 1 188,198,373 (GRCm39) missense possibly damaging 0.53
R1646:Ush2a UTSW 1 188,148,018 (GRCm39) missense probably damaging 1.00
R1660:Ush2a UTSW 1 188,648,261 (GRCm39) missense probably benign
R1676:Ush2a UTSW 1 188,460,782 (GRCm39) missense probably damaging 1.00
R1704:Ush2a UTSW 1 188,553,993 (GRCm39) missense probably damaging 1.00
R1705:Ush2a UTSW 1 188,643,738 (GRCm39) missense probably benign 0.40
R1705:Ush2a UTSW 1 188,607,066 (GRCm39) missense probably damaging 1.00
R1760:Ush2a UTSW 1 188,643,180 (GRCm39) missense possibly damaging 0.82
R1776:Ush2a UTSW 1 188,460,400 (GRCm39) missense possibly damaging 0.83
R1782:Ush2a UTSW 1 188,643,382 (GRCm39) missense probably benign 0.06
R1794:Ush2a UTSW 1 188,595,006 (GRCm39) missense probably benign 0.00
R1796:Ush2a UTSW 1 188,643,024 (GRCm39) missense probably benign 0.11
R1804:Ush2a UTSW 1 188,365,926 (GRCm39) critical splice donor site probably null
R1835:Ush2a UTSW 1 188,184,015 (GRCm39) missense probably benign 0.13
R1871:Ush2a UTSW 1 188,558,665 (GRCm39) missense probably benign 0.02
R1876:Ush2a UTSW 1 188,410,486 (GRCm39) missense possibly damaging 0.51
R1887:Ush2a UTSW 1 188,132,177 (GRCm39) missense probably benign 0.05
R1896:Ush2a UTSW 1 188,282,206 (GRCm39) missense probably benign 0.00
R1907:Ush2a UTSW 1 188,447,261 (GRCm39) missense probably benign 0.01
R1940:Ush2a UTSW 1 188,683,758 (GRCm39) missense probably null 0.89
R1950:Ush2a UTSW 1 188,487,382 (GRCm39) missense probably damaging 1.00
R1991:Ush2a UTSW 1 188,310,729 (GRCm39) splice site probably benign
R2043:Ush2a UTSW 1 188,648,453 (GRCm39) missense probably benign 0.00
R2046:Ush2a UTSW 1 188,089,124 (GRCm39) missense probably benign 0.01
R2059:Ush2a UTSW 1 188,113,746 (GRCm39) critical splice donor site probably null
R2239:Ush2a UTSW 1 188,308,411 (GRCm39) missense probably benign
R2365:Ush2a UTSW 1 188,111,188 (GRCm39) missense possibly damaging 0.68
R2395:Ush2a UTSW 1 188,679,237 (GRCm39) missense probably damaging 1.00
R2425:Ush2a UTSW 1 188,270,001 (GRCm39) missense possibly damaging 0.82
R2519:Ush2a UTSW 1 187,999,304 (GRCm39) missense probably benign
R3039:Ush2a UTSW 1 188,643,744 (GRCm39) missense probably damaging 0.99
R3434:Ush2a UTSW 1 188,465,955 (GRCm39) missense probably damaging 1.00
R3711:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3712:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3732:Ush2a UTSW 1 188,676,957 (GRCm39) missense probably benign 0.16
R3746:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3747:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3883:Ush2a UTSW 1 187,995,579 (GRCm39) missense probably benign
R3911:Ush2a UTSW 1 188,132,151 (GRCm39) missense probably benign 0.05
R3934:Ush2a UTSW 1 187,995,708 (GRCm39) critical splice donor site probably null
R3946:Ush2a UTSW 1 188,460,701 (GRCm39) missense probably benign 0.01
R3974:Ush2a UTSW 1 188,113,698 (GRCm39) missense probably benign 0.06
R4158:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4159:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4161:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4162:Ush2a UTSW 1 188,475,877 (GRCm39) missense probably benign 0.00
R4255:Ush2a UTSW 1 188,492,040 (GRCm39) nonsense probably null
R4280:Ush2a UTSW 1 188,310,658 (GRCm39) missense probably benign 0.16
R4387:Ush2a UTSW 1 188,175,628 (GRCm39) missense probably benign 0.00
R4416:Ush2a UTSW 1 188,089,071 (GRCm39) missense probably damaging 0.97
R4494:Ush2a UTSW 1 188,285,473 (GRCm39) missense possibly damaging 0.50
R4505:Ush2a UTSW 1 188,460,793 (GRCm39) missense possibly damaging 0.92
R4522:Ush2a UTSW 1 188,596,822 (GRCm39) missense probably damaging 1.00
R4584:Ush2a UTSW 1 188,183,995 (GRCm39) missense probably benign 0.00
R4599:Ush2a UTSW 1 188,643,844 (GRCm39) missense probably benign 0.01
R4605:Ush2a UTSW 1 188,642,998 (GRCm39) missense probably damaging 1.00
R4632:Ush2a UTSW 1 188,128,071 (GRCm39) missense possibly damaging 0.82
R4688:Ush2a UTSW 1 188,132,138 (GRCm39) missense probably benign 0.01
R4751:Ush2a UTSW 1 188,582,284 (GRCm39) missense probably damaging 0.98
R4770:Ush2a UTSW 1 188,282,076 (GRCm39) missense probably benign 0.25
R4771:Ush2a UTSW 1 188,529,966 (GRCm39) missense possibly damaging 0.92
R4798:Ush2a UTSW 1 188,475,742 (GRCm39) missense probably damaging 1.00
R4821:Ush2a UTSW 1 188,485,848 (GRCm39) missense probably benign 0.32
R4857:Ush2a UTSW 1 188,269,917 (GRCm39) missense probably benign 0.01
R4860:Ush2a UTSW 1 188,285,472 (GRCm39) missense probably benign 0.07
R4860:Ush2a UTSW 1 188,285,472 (GRCm39) missense probably benign 0.07
R4898:Ush2a UTSW 1 188,358,805 (GRCm39) missense probably benign 0.37
R4993:Ush2a UTSW 1 188,642,917 (GRCm39) missense probably benign 0.03
R5035:Ush2a UTSW 1 188,643,005 (GRCm39) missense probably damaging 1.00
R5061:Ush2a UTSW 1 188,689,471 (GRCm39) missense probably benign 0.03
R5150:Ush2a UTSW 1 188,184,067 (GRCm39) missense possibly damaging 0.95
R5205:Ush2a UTSW 1 188,607,133 (GRCm39) missense probably benign 0.21
R5212:Ush2a UTSW 1 188,176,902 (GRCm39) critical splice donor site probably null
R5252:Ush2a UTSW 1 188,553,914 (GRCm39) missense possibly damaging 0.83
R5260:Ush2a UTSW 1 188,679,276 (GRCm39) missense possibly damaging 0.95
R5304:Ush2a UTSW 1 188,088,995 (GRCm39) missense probably damaging 0.99
R5323:Ush2a UTSW 1 188,553,874 (GRCm39) critical splice acceptor site probably null
R5330:Ush2a UTSW 1 188,460,578 (GRCm39) missense probably benign 0.00
R5331:Ush2a UTSW 1 188,460,578 (GRCm39) missense probably benign 0.00
R5332:Ush2a UTSW 1 188,083,276 (GRCm39) missense probably damaging 1.00
R5371:Ush2a UTSW 1 188,175,267 (GRCm39) missense probably benign 0.00
R5374:Ush2a UTSW 1 188,487,403 (GRCm39) missense probably benign
R5377:Ush2a UTSW 1 188,644,320 (GRCm39) missense probably benign 0.00
R5525:Ush2a UTSW 1 188,485,803 (GRCm39) missense probably benign 0.01
R5558:Ush2a UTSW 1 188,530,024 (GRCm39) missense possibly damaging 0.47
R5562:Ush2a UTSW 1 188,308,414 (GRCm39) missense probably damaging 1.00
R5595:Ush2a UTSW 1 188,638,695 (GRCm39) missense possibly damaging 0.95
R5620:Ush2a UTSW 1 188,492,020 (GRCm39) missense possibly damaging 0.82
R5714:Ush2a UTSW 1 188,132,454 (GRCm39) missense probably benign 0.00
R5743:Ush2a UTSW 1 188,169,159 (GRCm39) missense probably benign 0.01
R5779:Ush2a UTSW 1 188,175,707 (GRCm39) critical splice donor site probably null
R5795:Ush2a UTSW 1 188,175,594 (GRCm39) missense probably benign 0.34
R5897:Ush2a UTSW 1 188,553,935 (GRCm39) missense probably damaging 1.00
R5918:Ush2a UTSW 1 188,089,011 (GRCm39) missense probably benign 0.26
R6000:Ush2a UTSW 1 187,999,223 (GRCm39) nonsense probably null
R6014:Ush2a UTSW 1 188,582,237 (GRCm39) missense probably damaging 0.98
R6017:Ush2a UTSW 1 188,689,711 (GRCm39) critical splice donor site probably null
R6020:Ush2a UTSW 1 188,460,293 (GRCm39) splice site probably null
R6039:Ush2a UTSW 1 188,051,217 (GRCm39) missense possibly damaging 0.76
R6039:Ush2a UTSW 1 188,051,217 (GRCm39) missense possibly damaging 0.76
R6050:Ush2a UTSW 1 188,689,521 (GRCm39) missense probably benign 0.06
R6083:Ush2a UTSW 1 187,999,220 (GRCm39) missense probably damaging 1.00
R6091:Ush2a UTSW 1 188,132,000 (GRCm39) missense probably damaging 1.00
R6120:Ush2a UTSW 1 188,090,800 (GRCm39) missense probably benign 0.04
R6135:Ush2a UTSW 1 188,644,303 (GRCm39) missense possibly damaging 0.68
R6141:Ush2a UTSW 1 188,090,160 (GRCm39) missense possibly damaging 0.71
R6157:Ush2a UTSW 1 188,460,467 (GRCm39) missense probably benign 0.00
R6180:Ush2a UTSW 1 188,132,068 (GRCm39) nonsense probably null
R6191:Ush2a UTSW 1 187,995,298 (GRCm39) nonsense probably null
R6217:Ush2a UTSW 1 188,475,651 (GRCm39) splice site probably null
R6263:Ush2a UTSW 1 188,090,839 (GRCm39) missense probably damaging 1.00
R6294:Ush2a UTSW 1 188,268,567 (GRCm39) missense possibly damaging 0.49
R6320:Ush2a UTSW 1 188,089,043 (GRCm39) missense probably benign 0.01
R6321:Ush2a UTSW 1 188,581,243 (GRCm39) nonsense probably null
R6347:Ush2a UTSW 1 188,643,084 (GRCm39) missense probably benign
R6382:Ush2a UTSW 1 188,546,499 (GRCm39) missense probably benign 0.01
R6408:Ush2a UTSW 1 187,999,229 (GRCm39) nonsense probably null
R6418:Ush2a UTSW 1 188,360,763 (GRCm39) missense probably damaging 1.00
R6500:Ush2a UTSW 1 188,573,724 (GRCm39) missense probably benign 0.00
R6504:Ush2a UTSW 1 188,643,444 (GRCm39) missense probably benign 0.00
R6534:Ush2a UTSW 1 188,183,999 (GRCm39) nonsense probably null
R6594:Ush2a UTSW 1 188,642,995 (GRCm39) missense possibly damaging 0.93
R6612:Ush2a UTSW 1 188,643,594 (GRCm39) missense possibly damaging 0.91
R6645:Ush2a UTSW 1 188,255,528 (GRCm39) missense probably damaging 0.99
R6658:Ush2a UTSW 1 188,546,556 (GRCm39) missense possibly damaging 0.95
R6726:Ush2a UTSW 1 188,485,881 (GRCm39) missense possibly damaging 0.85
R6755:Ush2a UTSW 1 188,175,416 (GRCm39) missense possibly damaging 0.95
R6782:Ush2a UTSW 1 188,089,031 (GRCm39) missense probably benign
R6817:Ush2a UTSW 1 188,595,061 (GRCm39) missense probably benign 0.03
R6834:Ush2a UTSW 1 188,088,989 (GRCm39) missense probably damaging 1.00
R6851:Ush2a UTSW 1 188,265,402 (GRCm39) missense probably benign 0.06
R6853:Ush2a UTSW 1 188,643,434 (GRCm39) nonsense probably null
R6867:Ush2a UTSW 1 188,643,170 (GRCm39) missense probably damaging 1.00
R6889:Ush2a UTSW 1 188,530,068 (GRCm39) missense probably damaging 1.00
R6931:Ush2a UTSW 1 188,460,580 (GRCm39) missense probably benign 0.01
R6953:Ush2a UTSW 1 187,995,342 (GRCm39) missense possibly damaging 0.94
R6966:Ush2a UTSW 1 188,308,441 (GRCm39) missense probably damaging 1.00
R7109:Ush2a UTSW 1 188,113,681 (GRCm39) missense probably benign 0.19
R7153:Ush2a UTSW 1 188,460,681 (GRCm39) missense possibly damaging 0.93
R7176:Ush2a UTSW 1 188,269,925 (GRCm39) missense probably benign 0.00
R7182:Ush2a UTSW 1 188,485,740 (GRCm39) missense probably benign 0.01
R7201:Ush2a UTSW 1 188,606,951 (GRCm39) missense probably benign
R7223:Ush2a UTSW 1 188,542,414 (GRCm39) missense probably benign 0.09
R7231:Ush2a UTSW 1 188,491,960 (GRCm39) missense possibly damaging 0.49
R7240:Ush2a UTSW 1 188,643,858 (GRCm39) missense possibly damaging 0.83
R7263:Ush2a UTSW 1 188,175,526 (GRCm39) missense possibly damaging 0.94
R7329:Ush2a UTSW 1 188,285,395 (GRCm39) missense probably damaging 0.97
R7343:Ush2a UTSW 1 188,147,943 (GRCm39) missense probably benign 0.00
R7352:Ush2a UTSW 1 188,198,321 (GRCm39) missense probably benign 0.04
R7384:Ush2a UTSW 1 188,132,360 (GRCm39) missense probably damaging 0.99
R7391:Ush2a UTSW 1 188,694,205 (GRCm39) small deletion probably benign
R7394:Ush2a UTSW 1 188,643,613 (GRCm39) missense possibly damaging 0.83
R7403:Ush2a UTSW 1 188,365,924 (GRCm39) missense probably damaging 1.00
R7408:Ush2a UTSW 1 188,465,726 (GRCm39) missense probably benign 0.00
R7453:Ush2a UTSW 1 188,285,308 (GRCm39) missense probably damaging 1.00
R7496:Ush2a UTSW 1 188,083,284 (GRCm39) missense possibly damaging 0.50
R7552:Ush2a UTSW 1 187,999,241 (GRCm39) missense possibly damaging 0.65
R7556:Ush2a UTSW 1 188,689,690 (GRCm39) missense probably benign 0.31
R7575:Ush2a UTSW 1 188,554,885 (GRCm39) missense possibly damaging 0.90
R7578:Ush2a UTSW 1 188,282,110 (GRCm39) missense probably damaging 1.00
R7584:Ush2a UTSW 1 188,460,306 (GRCm39) critical splice acceptor site probably null
R7589:Ush2a UTSW 1 188,275,046 (GRCm39) missense probably benign 0.00
R7602:Ush2a UTSW 1 188,380,606 (GRCm39) missense probably damaging 1.00
R7670:Ush2a UTSW 1 188,516,905 (GRCm39) missense possibly damaging 0.78
R7743:Ush2a UTSW 1 188,542,376 (GRCm39) missense probably benign 0.05
R7753:Ush2a UTSW 1 188,175,603 (GRCm39) missense probably benign 0.28
R7767:Ush2a UTSW 1 188,285,457 (GRCm39) missense probably benign 0.01
R7784:Ush2a UTSW 1 188,176,789 (GRCm39) missense possibly damaging 0.55
R7831:Ush2a UTSW 1 188,492,038 (GRCm39) missense probably damaging 0.98
R7834:Ush2a UTSW 1 188,465,637 (GRCm39) nonsense probably null
R7847:Ush2a UTSW 1 188,163,005 (GRCm39) missense probably damaging 1.00
R7926:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
R7969:Ush2a UTSW 1 188,558,568 (GRCm39) missense probably benign 0.02
R7978:Ush2a UTSW 1 188,132,135 (GRCm39) missense probably benign 0.00
R7990:Ush2a UTSW 1 188,274,996 (GRCm39) missense probably benign 0.00
R8001:Ush2a UTSW 1 188,643,261 (GRCm39) missense probably damaging 0.98
R8039:Ush2a UTSW 1 188,689,570 (GRCm39) missense probably damaging 1.00
R8077:Ush2a UTSW 1 188,275,025 (GRCm39) missense probably benign 0.01
R8165:Ush2a UTSW 1 188,183,952 (GRCm39) missense possibly damaging 0.70
R8208:Ush2a UTSW 1 188,606,990 (GRCm39) missense possibly damaging 0.95
R8220:Ush2a UTSW 1 188,460,863 (GRCm39) missense probably damaging 1.00
R8270:Ush2a UTSW 1 188,176,838 (GRCm39) missense probably benign 0.06
R8316:Ush2a UTSW 1 188,178,899 (GRCm39) missense probably benign 0.01
R8347:Ush2a UTSW 1 188,679,281 (GRCm39) missense probably benign 0.02
R8360:Ush2a UTSW 1 188,198,468 (GRCm39) missense probably benign 0.01
R8362:Ush2a UTSW 1 188,689,650 (GRCm39) missense probably damaging 0.96
R8386:Ush2a UTSW 1 188,460,403 (GRCm39) missense possibly damaging 0.80
R8401:Ush2a UTSW 1 188,275,062 (GRCm39) missense probably benign 0.10
R8439:Ush2a UTSW 1 188,582,254 (GRCm39) missense probably damaging 1.00
R8465:Ush2a UTSW 1 188,147,875 (GRCm39) missense probably damaging 1.00
R8478:Ush2a UTSW 1 188,175,429 (GRCm39) missense possibly damaging 0.83
R8540:Ush2a UTSW 1 188,274,858 (GRCm39) missense probably benign 0.00
R8684:Ush2a UTSW 1 188,643,220 (GRCm39) missense possibly damaging 0.45
R8685:Ush2a UTSW 1 188,198,401 (GRCm39) missense probably damaging 1.00
R8699:Ush2a UTSW 1 188,643,574 (GRCm39) missense probably damaging 1.00
R8720:Ush2a UTSW 1 188,090,715 (GRCm39) missense probably benign 0.05
R8754:Ush2a UTSW 1 188,581,162 (GRCm39) nonsense probably null
R8756:Ush2a UTSW 1 188,644,141 (GRCm39) missense possibly damaging 0.91
R8788:Ush2a UTSW 1 188,475,816 (GRCm39) nonsense probably null
R8817:Ush2a UTSW 1 187,995,231 (GRCm39) start codon destroyed probably benign 0.00
R8837:Ush2a UTSW 1 188,485,847 (GRCm39) missense probably benign
R8880:Ush2a UTSW 1 188,460,733 (GRCm39) missense probably benign 0.11
R8902:Ush2a UTSW 1 188,175,281 (GRCm39) missense probably damaging 0.98
R8918:Ush2a UTSW 1 188,270,017 (GRCm39) missense possibly damaging 0.85
R8940:Ush2a UTSW 1 188,132,505 (GRCm39) missense probably benign 0.02
R8968:Ush2a UTSW 1 188,127,956 (GRCm39) missense probably damaging 1.00
R8995:Ush2a UTSW 1 188,176,850 (GRCm39) missense probably damaging 0.98
R9011:Ush2a UTSW 1 188,638,676 (GRCm39) missense probably damaging 0.99
R9037:Ush2a UTSW 1 187,995,487 (GRCm39) missense possibly damaging 0.51
R9063:Ush2a UTSW 1 187,995,457 (GRCm39) missense probably benign 0.00
R9089:Ush2a UTSW 1 188,487,374 (GRCm39) nonsense probably null
R9096:Ush2a UTSW 1 188,198,333 (GRCm39) missense probably benign 0.00
R9118:Ush2a UTSW 1 188,386,839 (GRCm39) missense probably damaging 0.98
R9174:Ush2a UTSW 1 188,460,416 (GRCm39) missense probably damaging 0.99
R9210:Ush2a UTSW 1 188,516,866 (GRCm39) missense probably null 0.01
R9242:Ush2a UTSW 1 188,365,787 (GRCm39) missense probably damaging 1.00
R9321:Ush2a UTSW 1 188,089,148 (GRCm39) missense probably damaging 0.97
R9338:Ush2a UTSW 1 188,308,489 (GRCm39) critical splice donor site probably null
R9357:Ush2a UTSW 1 188,607,147 (GRCm39) missense probably benign 0.01
R9358:Ush2a UTSW 1 188,607,147 (GRCm39) missense probably benign 0.01
R9406:Ush2a UTSW 1 187,995,646 (GRCm39) missense probably benign 0.00
R9407:Ush2a UTSW 1 188,644,045 (GRCm39) missense probably damaging 1.00
R9428:Ush2a UTSW 1 188,175,316 (GRCm39) missense probably damaging 1.00
R9456:Ush2a UTSW 1 188,558,589 (GRCm39) missense probably benign 0.00
R9507:Ush2a UTSW 1 188,596,937 (GRCm39) nonsense probably null
R9509:Ush2a UTSW 1 188,648,440 (GRCm39) missense probably damaging 1.00
R9512:Ush2a UTSW 1 188,643,160 (GRCm39) missense probably damaging 0.99
R9564:Ush2a UTSW 1 188,268,551 (GRCm39) missense possibly damaging 0.90
R9612:Ush2a UTSW 1 188,092,063 (GRCm39) nonsense probably null
R9670:Ush2a UTSW 1 188,360,768 (GRCm39) missense probably benign 0.03
R9684:Ush2a UTSW 1 188,132,078 (GRCm39) missense possibly damaging 0.67
R9798:Ush2a UTSW 1 188,644,002 (GRCm39) missense possibly damaging 0.80
RF017:Ush2a UTSW 1 187,995,666 (GRCm39) missense probably damaging 1.00
U24488:Ush2a UTSW 1 188,162,963 (GRCm39) missense probably damaging 0.99
X0011:Ush2a UTSW 1 188,051,166 (GRCm39) missense probably benign 0.00
X0024:Ush2a UTSW 1 188,132,479 (GRCm39) missense probably damaging 1.00
X0026:Ush2a UTSW 1 188,051,222 (GRCm39) missense possibly damaging 0.94
X0062:Ush2a UTSW 1 188,282,051 (GRCm39) missense probably damaging 1.00
Y4340:Ush2a UTSW 1 188,475,826 (GRCm39) missense possibly damaging 0.87
Y4341:Ush2a UTSW 1 188,475,826 (GRCm39) missense possibly damaging 0.87
Z1088:Ush2a UTSW 1 188,679,201 (GRCm39) missense probably benign 0.26
Z1088:Ush2a UTSW 1 188,644,180 (GRCm39) missense probably benign
Z1176:Ush2a UTSW 1 188,089,038 (GRCm39) missense probably damaging 1.00
Z1177:Ush2a UTSW 1 188,644,407 (GRCm39) missense possibly damaging 0.77
Z1177:Ush2a UTSW 1 188,465,741 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATTCTGCAGGCAAAGCTG -3'
(R):5'- GGGAGTCTTCAATACCATCCCTG -3'

Sequencing Primer
(F):5'- CTGCAAGTAACTGGACACGGTG -3'
(R):5'- CTGGCACTTATCCGAGTTCAGATG -3'
Posted On 2021-04-30