Incidental Mutation 'R8803:Myo3b'
ID671597
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8803 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70252994 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 664 (S664P)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: S664P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: S664P

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: S636P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: S636P

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,545,256 S431T probably benign Het
Acot7 T G 4: 152,217,815 V128G probably damaging Het
Actn3 T C 19: 4,864,663 D508G probably benign Het
Adam18 T C 8: 24,647,862 I321V probably benign Het
Ak1 T C 2: 32,633,478 V186A probably benign Het
Aldh3a2 A G 11: 61,248,930 F459L probably benign Het
Atp11a T C 8: 12,825,721 L256P probably benign Het
Bcan T C 3: 87,996,692 E162G probably benign Het
Birc6 A G 17: 74,652,038 Q3850R probably damaging Het
Btla A G 16: 45,239,067 T45A probably benign Het
Cad T G 5: 31,069,564 S1222A probably damaging Het
Cbarp A G 10: 80,137,142 V39A possibly damaging Het
Cct2 A C 10: 117,058,185 D221E probably benign Het
Cmya5 T C 13: 93,041,483 D3621G probably damaging Het
Col20a1 G T 2: 181,001,338 R867L possibly damaging Het
Cops3 A G 11: 59,827,976 V164A probably benign Het
Crygf A G 1: 65,927,989 R91G probably damaging Het
Csmd2 T A 4: 128,546,684 S3181T Het
Cyb5r1 G T 1: 134,405,958 probably benign Het
Dennd6b T A 15: 89,186,180 I429F probably benign Het
Dock1 A G 7: 134,874,087 T864A probably benign Het
Eea1 A T 10: 96,023,991 D713V probably benign Het
Fam78b G A 1: 167,001,591 C9Y probably damaging Het
Gga2 A C 7: 121,997,779 D371E probably benign Het
Gtpbp6 A T 5: 110,107,320 V2E unknown Het
Hectd4 A T 5: 121,323,931 M954L probably benign Het
Hmcn1 A G 1: 150,734,497 C1474R probably damaging Het
Igkv1-99 G T 6: 68,542,386 G109V Het
Izumo3 T C 4: 92,145,073 probably null Het
Kremen1 T C 11: 5,194,981 D465G probably benign Het
Ksr1 T C 11: 79,146,056 E75G probably benign Het
Mmp17 G T 5: 129,598,709 E311* probably null Het
Mmrn1 T A 6: 60,988,287 F1101I probably damaging Het
Muc13 G A 16: 33,812,917 probably benign Het
Myl4 T A 11: 104,584,577 M147K probably damaging Het
Myo1a T A 10: 127,710,987 N334K probably benign Het
Nptxr T C 15: 79,794,454 N211D probably damaging Het
Ntf5 A G 7: 45,416,061 T206A probably benign Het
Obscn T A 11: 59,054,403 E4596D probably benign Het
Olfr1316 T C 2: 112,130,082 H243R probably damaging Het
Olfr1426 T C 19: 12,088,105 E229G probably benign Het
Olfr1469 A T 19: 13,410,673 I35F probably damaging Het
Olfr860 A T 9: 19,846,166 I151N possibly damaging Het
Olfr988 T A 2: 85,353,734 Q64L probably damaging Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Paip2 A G 18: 35,616,220 N114D possibly damaging Het
Pcnx T C 12: 81,993,151 S2071P possibly damaging Het
Pcsk2 A G 2: 143,795,950 T369A probably damaging Het
Ppp1r12b A C 1: 134,890,754 probably benign Het
Ppp1r35 T A 5: 137,779,469 D132E possibly damaging Het
Pramel7 A T 2: 87,490,061 V296E probably benign Het
Prh1 C T 6: 132,571,985 P152S unknown Het
Pygl T C 12: 70,195,616 T689A probably damaging Het
Rasgef1b T C 5: 99,221,410 S450G probably benign Het
Rtn4ip1 G T 10: 43,907,846 R121L probably damaging Het
Scarf2 A T 16: 17,802,831 H121L probably damaging Het
Selenbp1 C A 3: 94,944,510 A454E possibly damaging Het
Slc7a9 A G 7: 35,463,718 I449M possibly damaging Het
Snapc2 C T 8: 4,255,558 H278Y probably damaging Het
Stambp C T 6: 83,547,230 probably null Het
Syne1 T C 10: 5,361,535 Y550C probably damaging Het
Tas2r113 T C 6: 132,893,141 V44A possibly damaging Het
Trpv4 T C 5: 114,634,755 T305A probably benign Het
Twf1 T C 15: 94,581,255 Y241C probably damaging Het
Ugt2a3 T C 5: 87,336,530 K212E probably damaging Het
Ush2a A T 1: 188,944,801 H4770L probably benign Het
Zfc3h1 T C 10: 115,411,895 V1001A probably benign Het
Zfp335 C T 2: 164,909,370 R92Q probably benign Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
R8843:Myo3b UTSW 2 70257981 missense probably damaging 1.00
R8896:Myo3b UTSW 2 70238816 missense probably damaging 1.00
R8904:Myo3b UTSW 2 70426908 missense probably benign 0.07
R8909:Myo3b UTSW 2 70253096 missense probably damaging 1.00
R9031:Myo3b UTSW 2 70251750 missense probably damaging 0.99
R9052:Myo3b UTSW 2 70232403 missense probably benign 0.00
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAAACAGTTTTGGAGTTGTGC -3'
(R):5'- TGATCACTCTAGGCCTCTGC -3'

Sequencing Primer
(F):5'- CACAGGTGCTTCTTGGAGTCAG -3'
(R):5'- GGGGACGACTTGCCATATG -3'
Posted On2021-04-30