Incidental Mutation 'R8803:Myo3b'
ID 671597
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 068640-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8803 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70083338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 664 (S664P)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: S664P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: S664P

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: S636P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: S636P

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,998,290 (GRCm39) S431T probably benign Het
Acot7 T G 4: 152,302,272 (GRCm39) V128G probably damaging Het
Actn3 T C 19: 4,914,691 (GRCm39) D508G probably benign Het
Adam18 T C 8: 25,137,878 (GRCm39) I321V probably benign Het
Ak1 T C 2: 32,523,490 (GRCm39) V186A probably benign Het
Aldh3a2 A G 11: 61,139,756 (GRCm39) F459L probably benign Het
Atp11a T C 8: 12,875,721 (GRCm39) L256P probably benign Het
Bcan T C 3: 87,903,999 (GRCm39) E162G probably benign Het
Birc6 A G 17: 74,959,033 (GRCm39) Q3850R probably damaging Het
Btf3l4 T G 4: 108,689,084 (GRCm39) probably benign Het
Btla A G 16: 45,059,430 (GRCm39) T45A probably benign Het
Cad T G 5: 31,226,908 (GRCm39) S1222A probably damaging Het
Cbarp A G 10: 79,972,976 (GRCm39) V39A possibly damaging Het
Cct2 A C 10: 116,894,090 (GRCm39) D221E probably benign Het
Cmya5 T C 13: 93,177,991 (GRCm39) D3621G probably damaging Het
Col20a1 G T 2: 180,643,131 (GRCm39) R867L possibly damaging Het
Cops3 A G 11: 59,718,802 (GRCm39) V164A probably benign Het
Crygf A G 1: 65,967,148 (GRCm39) R91G probably damaging Het
Csmd2 T A 4: 128,440,477 (GRCm39) S3181T Het
Cyb5r1 G T 1: 134,333,696 (GRCm39) probably benign Het
Dennd6b T A 15: 89,070,383 (GRCm39) I429F probably benign Het
Dock1 A G 7: 134,475,816 (GRCm39) T864A probably benign Het
Eea1 A T 10: 95,859,853 (GRCm39) D713V probably benign Het
Fam78b G A 1: 166,829,160 (GRCm39) C9Y probably damaging Het
Gga2 A C 7: 121,597,002 (GRCm39) D371E probably benign Het
Gtpbp6 A T 5: 110,255,186 (GRCm39) V2E unknown Het
Hectd4 A T 5: 121,461,994 (GRCm39) M954L probably benign Het
Hmcn1 A G 1: 150,610,248 (GRCm39) C1474R probably damaging Het
Igkv1-99 G T 6: 68,519,370 (GRCm39) G109V Het
Izumo3 T C 4: 92,033,310 (GRCm39) probably null Het
Kremen1 T C 11: 5,144,981 (GRCm39) D465G probably benign Het
Ksr1 T C 11: 79,036,882 (GRCm39) E75G probably benign Het
Mmp17 G T 5: 129,675,773 (GRCm39) E311* probably null Het
Mmrn1 T A 6: 60,965,271 (GRCm39) F1101I probably damaging Het
Muc13 G A 16: 33,633,287 (GRCm39) probably benign Het
Myl4 T A 11: 104,475,403 (GRCm39) M147K probably damaging Het
Myo1a T A 10: 127,546,856 (GRCm39) N334K probably benign Het
Nptxr T C 15: 79,678,655 (GRCm39) N211D probably damaging Het
Ntf5 A G 7: 45,065,485 (GRCm39) T206A probably benign Het
Obscn T A 11: 58,945,229 (GRCm39) E4596D probably benign Het
Or4d10c T C 19: 12,065,469 (GRCm39) E229G probably benign Het
Or4f14d T C 2: 111,960,427 (GRCm39) H243R probably damaging Het
Or5ak20 T A 2: 85,184,078 (GRCm39) Q64L probably damaging Het
Or5ak25 T A 2: 85,268,981 (GRCm39) I174F probably damaging Het
Or5b3 A T 19: 13,388,037 (GRCm39) I35F probably damaging Het
Or7e169 A T 9: 19,757,462 (GRCm39) I151N possibly damaging Het
Paip2 A G 18: 35,749,273 (GRCm39) N114D possibly damaging Het
Pcnx1 T C 12: 82,039,925 (GRCm39) S2071P possibly damaging Het
Pcsk2 A G 2: 143,637,870 (GRCm39) T369A probably damaging Het
Ppp1r12b A C 1: 134,818,492 (GRCm39) probably benign Het
Ppp1r35 T A 5: 137,777,731 (GRCm39) D132E possibly damaging Het
Pramel7 A T 2: 87,320,405 (GRCm39) V296E probably benign Het
Prh1 C T 6: 132,548,948 (GRCm39) P152S unknown Het
Pygl T C 12: 70,242,390 (GRCm39) T689A probably damaging Het
Rasgef1b T C 5: 99,369,269 (GRCm39) S450G probably benign Het
Rtn4ip1 G T 10: 43,783,842 (GRCm39) R121L probably damaging Het
Scarf2 A T 16: 17,620,695 (GRCm39) H121L probably damaging Het
Selenbp1 C A 3: 94,851,821 (GRCm39) A454E possibly damaging Het
Slc7a9 A G 7: 35,163,143 (GRCm39) I449M possibly damaging Het
Snapc2 C T 8: 4,305,558 (GRCm39) H278Y probably damaging Het
Stambp C T 6: 83,524,212 (GRCm39) probably null Het
Syne1 T C 10: 5,311,535 (GRCm39) Y550C probably damaging Het
Tas2r113 T C 6: 132,870,104 (GRCm39) V44A possibly damaging Het
Trpv4 T C 5: 114,772,816 (GRCm39) T305A probably benign Het
Twf1 T C 15: 94,479,136 (GRCm39) Y241C probably damaging Het
Ugt2a3 T C 5: 87,484,389 (GRCm39) K212E probably damaging Het
Ush2a A T 1: 188,676,998 (GRCm39) H4770L probably benign Het
Zfc3h1 T C 10: 115,247,800 (GRCm39) V1001A probably benign Het
Zfp335 C T 2: 164,751,290 (GRCm39) R92Q probably benign Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAACAGTTTTGGAGTTGTGC -3'
(R):5'- TGATCACTCTAGGCCTCTGC -3'

Sequencing Primer
(F):5'- CACAGGTGCTTCTTGGAGTCAG -3'
(R):5'- GGGGACGACTTGCCATATG -3'
Posted On 2021-04-30