Incidental Mutation 'R8803:Or4f14d'
ID 671601
Institutional Source Beutler Lab
Gene Symbol Or4f14d
Ensembl Gene ENSMUSG00000109801
Gene Name olfactory receptor family 4 subfamily F member 14D
Synonyms MOR245-1, Olfr1316, GA_x6K02T2Q125-73177039-73176101, MOR245-26
MMRRC Submission 068640-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R8803 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111960216-111961160 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111960427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 243 (H243R)
Ref Sequence ENSEMBL: ENSMUSP00000149103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099596] [ENSMUST00000213696]
AlphaFold Q8VG12
Predicted Effect probably damaging
Transcript: ENSMUST00000099596
AA Change: H245R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097191
Gene: ENSMUSG00000109801
AA Change: H245R

DomainStartEndE-ValueType
Pfam:7tm_4 32 307 5.9e-41 PFAM
Pfam:7tm_1 43 289 2.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213696
AA Change: H243R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,998,290 (GRCm39) S431T probably benign Het
Acot7 T G 4: 152,302,272 (GRCm39) V128G probably damaging Het
Actn3 T C 19: 4,914,691 (GRCm39) D508G probably benign Het
Adam18 T C 8: 25,137,878 (GRCm39) I321V probably benign Het
Ak1 T C 2: 32,523,490 (GRCm39) V186A probably benign Het
Aldh3a2 A G 11: 61,139,756 (GRCm39) F459L probably benign Het
Atp11a T C 8: 12,875,721 (GRCm39) L256P probably benign Het
Bcan T C 3: 87,903,999 (GRCm39) E162G probably benign Het
Birc6 A G 17: 74,959,033 (GRCm39) Q3850R probably damaging Het
Btf3l4 T G 4: 108,689,084 (GRCm39) probably benign Het
Btla A G 16: 45,059,430 (GRCm39) T45A probably benign Het
Cad T G 5: 31,226,908 (GRCm39) S1222A probably damaging Het
Cbarp A G 10: 79,972,976 (GRCm39) V39A possibly damaging Het
Cct2 A C 10: 116,894,090 (GRCm39) D221E probably benign Het
Cmya5 T C 13: 93,177,991 (GRCm39) D3621G probably damaging Het
Col20a1 G T 2: 180,643,131 (GRCm39) R867L possibly damaging Het
Cops3 A G 11: 59,718,802 (GRCm39) V164A probably benign Het
Crygf A G 1: 65,967,148 (GRCm39) R91G probably damaging Het
Csmd2 T A 4: 128,440,477 (GRCm39) S3181T Het
Cyb5r1 G T 1: 134,333,696 (GRCm39) probably benign Het
Dennd6b T A 15: 89,070,383 (GRCm39) I429F probably benign Het
Dock1 A G 7: 134,475,816 (GRCm39) T864A probably benign Het
Eea1 A T 10: 95,859,853 (GRCm39) D713V probably benign Het
Fam78b G A 1: 166,829,160 (GRCm39) C9Y probably damaging Het
Gga2 A C 7: 121,597,002 (GRCm39) D371E probably benign Het
Gtpbp6 A T 5: 110,255,186 (GRCm39) V2E unknown Het
Hectd4 A T 5: 121,461,994 (GRCm39) M954L probably benign Het
Hmcn1 A G 1: 150,610,248 (GRCm39) C1474R probably damaging Het
Igkv1-99 G T 6: 68,519,370 (GRCm39) G109V Het
Izumo3 T C 4: 92,033,310 (GRCm39) probably null Het
Kremen1 T C 11: 5,144,981 (GRCm39) D465G probably benign Het
Ksr1 T C 11: 79,036,882 (GRCm39) E75G probably benign Het
Mmp17 G T 5: 129,675,773 (GRCm39) E311* probably null Het
Mmrn1 T A 6: 60,965,271 (GRCm39) F1101I probably damaging Het
Muc13 G A 16: 33,633,287 (GRCm39) probably benign Het
Myl4 T A 11: 104,475,403 (GRCm39) M147K probably damaging Het
Myo1a T A 10: 127,546,856 (GRCm39) N334K probably benign Het
Myo3b T C 2: 70,083,338 (GRCm39) S664P probably benign Het
Nptxr T C 15: 79,678,655 (GRCm39) N211D probably damaging Het
Ntf5 A G 7: 45,065,485 (GRCm39) T206A probably benign Het
Obscn T A 11: 58,945,229 (GRCm39) E4596D probably benign Het
Or4d10c T C 19: 12,065,469 (GRCm39) E229G probably benign Het
Or5ak20 T A 2: 85,184,078 (GRCm39) Q64L probably damaging Het
Or5ak25 T A 2: 85,268,981 (GRCm39) I174F probably damaging Het
Or5b3 A T 19: 13,388,037 (GRCm39) I35F probably damaging Het
Or7e169 A T 9: 19,757,462 (GRCm39) I151N possibly damaging Het
Paip2 A G 18: 35,749,273 (GRCm39) N114D possibly damaging Het
Pcnx1 T C 12: 82,039,925 (GRCm39) S2071P possibly damaging Het
Pcsk2 A G 2: 143,637,870 (GRCm39) T369A probably damaging Het
Ppp1r12b A C 1: 134,818,492 (GRCm39) probably benign Het
Ppp1r35 T A 5: 137,777,731 (GRCm39) D132E possibly damaging Het
Pramel7 A T 2: 87,320,405 (GRCm39) V296E probably benign Het
Prh1 C T 6: 132,548,948 (GRCm39) P152S unknown Het
Pygl T C 12: 70,242,390 (GRCm39) T689A probably damaging Het
Rasgef1b T C 5: 99,369,269 (GRCm39) S450G probably benign Het
Rtn4ip1 G T 10: 43,783,842 (GRCm39) R121L probably damaging Het
Scarf2 A T 16: 17,620,695 (GRCm39) H121L probably damaging Het
Selenbp1 C A 3: 94,851,821 (GRCm39) A454E possibly damaging Het
Slc7a9 A G 7: 35,163,143 (GRCm39) I449M possibly damaging Het
Snapc2 C T 8: 4,305,558 (GRCm39) H278Y probably damaging Het
Stambp C T 6: 83,524,212 (GRCm39) probably null Het
Syne1 T C 10: 5,311,535 (GRCm39) Y550C probably damaging Het
Tas2r113 T C 6: 132,870,104 (GRCm39) V44A possibly damaging Het
Trpv4 T C 5: 114,772,816 (GRCm39) T305A probably benign Het
Twf1 T C 15: 94,479,136 (GRCm39) Y241C probably damaging Het
Ugt2a3 T C 5: 87,484,389 (GRCm39) K212E probably damaging Het
Ush2a A T 1: 188,676,998 (GRCm39) H4770L probably benign Het
Zfc3h1 T C 10: 115,247,800 (GRCm39) V1001A probably benign Het
Zfp335 C T 2: 164,751,290 (GRCm39) R92Q probably benign Het
Other mutations in Or4f14d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02072:Or4f14d APN 2 111,960,426 (GRCm39) missense probably damaging 1.00
R5120:Or4f14d UTSW 2 111,960,903 (GRCm39) missense probably damaging 1.00
R5849:Or4f14d UTSW 2 111,960,223 (GRCm39) missense probably benign 0.01
R6045:Or4f14d UTSW 2 111,960,881 (GRCm39) missense possibly damaging 0.69
R6156:Or4f14d UTSW 2 111,960,445 (GRCm39) missense probably damaging 1.00
R7621:Or4f14d UTSW 2 111,960,926 (GRCm39) missense probably benign 0.00
R7733:Or4f14d UTSW 2 111,960,386 (GRCm39) missense probably benign 0.01
R8480:Or4f14d UTSW 2 111,960,330 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CAGTAGCTGTTTGAACACTCTC -3'
(R):5'- AATGTGTTGGACAGCTTCTACTG -3'

Sequencing Primer
(F):5'- AGCTGTTTGAACACTCTCTTCATTG -3'
(R):5'- CGGTTCATCAAGCTTGCTTG -3'
Posted On 2021-04-30