Incidental Mutation 'R8803:Zfp335'
ID671603
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8803 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164909370 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 92 (R92Q)
Ref Sequence ENSEMBL: ENSMUSP00000038298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000139247] [ENSMUST00000183830]
Predicted Effect probably benign
Transcript: ENSMUST00000041361
AA Change: R92Q

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: R92Q

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139247
SMART Domains Protein: ENSMUSP00000138664
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
AA Change: R92Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834
AA Change: R92Q

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,545,256 S431T probably benign Het
Acot7 T G 4: 152,217,815 V128G probably damaging Het
Actn3 T C 19: 4,864,663 D508G probably benign Het
Adam18 T C 8: 24,647,862 I321V probably benign Het
Ak1 T C 2: 32,633,478 V186A probably benign Het
Aldh3a2 A G 11: 61,248,930 F459L probably benign Het
Atp11a T C 8: 12,825,721 L256P probably benign Het
Bcan T C 3: 87,996,692 E162G probably benign Het
Birc6 A G 17: 74,652,038 Q3850R probably damaging Het
Btla A G 16: 45,239,067 T45A probably benign Het
Cad T G 5: 31,069,564 S1222A probably damaging Het
Cbarp A G 10: 80,137,142 V39A possibly damaging Het
Cct2 A C 10: 117,058,185 D221E probably benign Het
Cmya5 T C 13: 93,041,483 D3621G probably damaging Het
Col20a1 G T 2: 181,001,338 R867L possibly damaging Het
Cops3 A G 11: 59,827,976 V164A probably benign Het
Crygf A G 1: 65,927,989 R91G probably damaging Het
Csmd2 T A 4: 128,546,684 S3181T Het
Cyb5r1 G T 1: 134,405,958 probably benign Het
Dennd6b T A 15: 89,186,180 I429F probably benign Het
Dock1 A G 7: 134,874,087 T864A probably benign Het
Eea1 A T 10: 96,023,991 D713V probably benign Het
Fam78b G A 1: 167,001,591 C9Y probably damaging Het
Gga2 A C 7: 121,997,779 D371E probably benign Het
Gtpbp6 A T 5: 110,107,320 V2E unknown Het
Hectd4 A T 5: 121,323,931 M954L probably benign Het
Hmcn1 A G 1: 150,734,497 C1474R probably damaging Het
Igkv1-99 G T 6: 68,542,386 G109V Het
Izumo3 T C 4: 92,145,073 probably null Het
Kremen1 T C 11: 5,194,981 D465G probably benign Het
Ksr1 T C 11: 79,146,056 E75G probably benign Het
Mmp17 G T 5: 129,598,709 E311* probably null Het
Mmrn1 T A 6: 60,988,287 F1101I probably damaging Het
Muc13 G A 16: 33,812,917 probably benign Het
Myl4 T A 11: 104,584,577 M147K probably damaging Het
Myo1a T A 10: 127,710,987 N334K probably benign Het
Myo3b T C 2: 70,252,994 S664P probably benign Het
Nptxr T C 15: 79,794,454 N211D probably damaging Het
Ntf5 A G 7: 45,416,061 T206A probably benign Het
Obscn T A 11: 59,054,403 E4596D probably benign Het
Olfr1316 T C 2: 112,130,082 H243R probably damaging Het
Olfr1426 T C 19: 12,088,105 E229G probably benign Het
Olfr1469 A T 19: 13,410,673 I35F probably damaging Het
Olfr860 A T 9: 19,846,166 I151N possibly damaging Het
Olfr988 T A 2: 85,353,734 Q64L probably damaging Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Paip2 A G 18: 35,616,220 N114D possibly damaging Het
Pcnx T C 12: 81,993,151 S2071P possibly damaging Het
Pcsk2 A G 2: 143,795,950 T369A probably damaging Het
Ppp1r12b A C 1: 134,890,754 probably benign Het
Ppp1r35 T A 5: 137,779,469 D132E possibly damaging Het
Pramel7 A T 2: 87,490,061 V296E probably benign Het
Prh1 C T 6: 132,571,985 P152S unknown Het
Pygl T C 12: 70,195,616 T689A probably damaging Het
Rasgef1b T C 5: 99,221,410 S450G probably benign Het
Rtn4ip1 G T 10: 43,907,846 R121L probably damaging Het
Scarf2 A T 16: 17,802,831 H121L probably damaging Het
Selenbp1 C A 3: 94,944,510 A454E possibly damaging Het
Slc7a9 A G 7: 35,463,718 I449M possibly damaging Het
Snapc2 C T 8: 4,255,558 H278Y probably damaging Het
Stambp C T 6: 83,547,230 probably null Het
Syne1 T C 10: 5,361,535 Y550C probably damaging Het
Tas2r113 T C 6: 132,893,141 V44A possibly damaging Het
Trpv4 T C 5: 114,634,755 T305A probably benign Het
Twf1 T C 15: 94,581,255 Y241C probably damaging Het
Ugt2a3 T C 5: 87,336,530 K212E probably damaging Het
Ush2a A T 1: 188,944,801 H4770L probably benign Het
Zfc3h1 T C 10: 115,411,895 V1001A probably benign Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
PIT4403001:Zfp335 UTSW 2 164893716 missense possibly damaging 0.56
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
R7174:Zfp335 UTSW 2 164902503 missense probably damaging 1.00
R7185:Zfp335 UTSW 2 164893244 critical splice donor site probably null
R7296:Zfp335 UTSW 2 164900132 missense probably damaging 0.99
R7322:Zfp335 UTSW 2 164910821 start codon destroyed probably null 0.90
R7504:Zfp335 UTSW 2 164909418 missense probably benign 0.27
R7560:Zfp335 UTSW 2 164895992 missense probably damaging 1.00
R7637:Zfp335 UTSW 2 164892539 critical splice donor site probably null
R8064:Zfp335 UTSW 2 164907700 missense probably damaging 1.00
R8208:Zfp335 UTSW 2 164893616 critical splice acceptor site probably null
R8228:Zfp335 UTSW 2 164904898 missense probably damaging 1.00
R8271:Zfp335 UTSW 2 164898053 missense probably damaging 0.98
R8688:Zfp335 UTSW 2 164892193 missense probably damaging 1.00
RF031:Zfp335 UTSW 2 164907463 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCACTCTGGATGAGGTCTGG -3'
(R):5'- TGACTATATCTGTGGGCCCTCAC -3'

Sequencing Primer
(F):5'- CTGGACCAATGGTAGATTCGATGATC -3'
(R):5'- CCTCTGTAAGGCTGAAATGTGG -3'
Posted On2021-04-30