Incidental Mutation 'R8803:Selenbp1'
ID 671606
Institutional Source Beutler Lab
Gene Symbol Selenbp1
Ensembl Gene ENSMUSG00000068874
Gene Name selenium binding protein 1
Synonyms Lp56, Lpsb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 94933056-94944758 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 94944510 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 454 (A454E)
Ref Sequence ENSEMBL: ENSMUSP00000088349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090839] [ENSMUST00000134202] [ENSMUST00000140757]
AlphaFold P17563
Predicted Effect possibly damaging
Transcript: ENSMUST00000090839
AA Change: A454E

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088349
Gene: ENSMUSG00000068874
AA Change: A454E

DomainStartEndE-ValueType
Pfam:SBP56 6 472 3.2e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134202
SMART Domains Protein: ENSMUSP00000120159
Gene: ENSMUSG00000068874

DomainStartEndE-ValueType
Pfam:SBP56 6 123 4.7e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140757
SMART Domains Protein: ENSMUSP00000118563
Gene: ENSMUSG00000068874

DomainStartEndE-ValueType
Pfam:SBP56 6 123 4.7e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit sex-specific changes in organ weights. Mice homozygous for a different allele lack methanethiol oxidase activity and exhibit an increase in dimethylsulfide and dimethyl-sulfone serum levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,545,256 S431T probably benign Het
Acot7 T G 4: 152,217,815 V128G probably damaging Het
Actn3 T C 19: 4,864,663 D508G probably benign Het
Adam18 T C 8: 24,647,862 I321V probably benign Het
Ak1 T C 2: 32,633,478 V186A probably benign Het
Aldh3a2 A G 11: 61,248,930 F459L probably benign Het
Atp11a T C 8: 12,825,721 L256P probably benign Het
Bcan T C 3: 87,996,692 E162G probably benign Het
Birc6 A G 17: 74,652,038 Q3850R probably damaging Het
Btf3l4 T G 4: 108,831,887 probably benign Het
Btla A G 16: 45,239,067 T45A probably benign Het
Cad T G 5: 31,069,564 S1222A probably damaging Het
Cbarp A G 10: 80,137,142 V39A possibly damaging Het
Cct2 A C 10: 117,058,185 D221E probably benign Het
Cmya5 T C 13: 93,041,483 D3621G probably damaging Het
Col20a1 G T 2: 181,001,338 R867L possibly damaging Het
Cops3 A G 11: 59,827,976 V164A probably benign Het
Crygf A G 1: 65,927,989 R91G probably damaging Het
Csmd2 T A 4: 128,546,684 S3181T Het
Cyb5r1 G T 1: 134,405,958 probably benign Het
Dennd6b T A 15: 89,186,180 I429F probably benign Het
Dock1 A G 7: 134,874,087 T864A probably benign Het
Eea1 A T 10: 96,023,991 D713V probably benign Het
Fam78b G A 1: 167,001,591 C9Y probably damaging Het
Gga2 A C 7: 121,997,779 D371E probably benign Het
Gtpbp6 A T 5: 110,107,320 V2E unknown Het
Hectd4 A T 5: 121,323,931 M954L probably benign Het
Hmcn1 A G 1: 150,734,497 C1474R probably damaging Het
Igkv1-99 G T 6: 68,542,386 G109V Het
Izumo3 T C 4: 92,145,073 probably null Het
Kremen1 T C 11: 5,194,981 D465G probably benign Het
Ksr1 T C 11: 79,146,056 E75G probably benign Het
Mmp17 G T 5: 129,598,709 E311* probably null Het
Mmrn1 T A 6: 60,988,287 F1101I probably damaging Het
Muc13 G A 16: 33,812,917 probably benign Het
Myl4 T A 11: 104,584,577 M147K probably damaging Het
Myo1a T A 10: 127,710,987 N334K probably benign Het
Myo3b T C 2: 70,252,994 S664P probably benign Het
Nptxr T C 15: 79,794,454 N211D probably damaging Het
Ntf5 A G 7: 45,416,061 T206A probably benign Het
Obscn T A 11: 59,054,403 E4596D probably benign Het
Olfr1316 T C 2: 112,130,082 H243R probably damaging Het
Olfr1426 T C 19: 12,088,105 E229G probably benign Het
Olfr1469 A T 19: 13,410,673 I35F probably damaging Het
Olfr860 A T 9: 19,846,166 I151N possibly damaging Het
Olfr988 T A 2: 85,353,734 Q64L probably damaging Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Paip2 A G 18: 35,616,220 N114D possibly damaging Het
Pcnx T C 12: 81,993,151 S2071P possibly damaging Het
Pcsk2 A G 2: 143,795,950 T369A probably damaging Het
Ppp1r12b A C 1: 134,890,754 probably benign Het
Ppp1r35 T A 5: 137,779,469 D132E possibly damaging Het
Pramel7 A T 2: 87,490,061 V296E probably benign Het
Prh1 C T 6: 132,571,985 P152S unknown Het
Pygl T C 12: 70,195,616 T689A probably damaging Het
Rasgef1b T C 5: 99,221,410 S450G probably benign Het
Rtn4ip1 G T 10: 43,907,846 R121L probably damaging Het
Scarf2 A T 16: 17,802,831 H121L probably damaging Het
Slc7a9 A G 7: 35,463,718 I449M possibly damaging Het
Snapc2 C T 8: 4,255,558 H278Y probably damaging Het
Stambp C T 6: 83,547,230 probably null Het
Syne1 T C 10: 5,361,535 Y550C probably damaging Het
Tas2r113 T C 6: 132,893,141 V44A possibly damaging Het
Trpv4 T C 5: 114,634,755 T305A probably benign Het
Twf1 T C 15: 94,581,255 Y241C probably damaging Het
Ugt2a3 T C 5: 87,336,530 K212E probably damaging Het
Ush2a A T 1: 188,944,801 H4770L probably benign Het
Zfc3h1 T C 10: 115,411,895 V1001A probably benign Het
Zfp335 C T 2: 164,909,370 R92Q probably benign Het
Other mutations in Selenbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Selenbp1 APN 3 94937002 missense probably benign 0.24
IGL03281:Selenbp1 APN 3 94937310 nonsense probably null
PIT4131001:Selenbp1 UTSW 3 94937296 missense probably damaging 0.99
R0415:Selenbp1 UTSW 3 94936913 missense possibly damaging 0.61
R1132:Selenbp1 UTSW 3 94937333 missense probably benign 0.02
R1421:Selenbp1 UTSW 3 94943872 missense probably benign
R1522:Selenbp1 UTSW 3 94937358 missense probably damaging 1.00
R1676:Selenbp1 UTSW 3 94944543 missense probably damaging 1.00
R1701:Selenbp1 UTSW 3 94937390 missense probably damaging 1.00
R2152:Selenbp1 UTSW 3 94944130 missense probably damaging 1.00
R3033:Selenbp1 UTSW 3 94938040 missense probably benign 0.22
R4363:Selenbp1 UTSW 3 94942749 splice site probably null
R4631:Selenbp1 UTSW 3 94944568 makesense probably null
R4798:Selenbp1 UTSW 3 94943900 missense probably benign 0.27
R4935:Selenbp1 UTSW 3 94937958 missense probably benign 0.10
R5464:Selenbp1 UTSW 3 94944416 missense probably benign
R6253:Selenbp1 UTSW 3 94943846 missense possibly damaging 0.95
R6314:Selenbp1 UTSW 3 94937265 missense probably damaging 1.00
R7199:Selenbp1 UTSW 3 94944434 missense possibly damaging 0.79
R7330:Selenbp1 UTSW 3 94939710 missense probably benign
R7637:Selenbp1 UTSW 3 94937348 nonsense probably null
R7658:Selenbp1 UTSW 3 94944102 missense probably benign 0.03
R8739:Selenbp1 UTSW 3 94937290 missense probably damaging 0.99
R8987:Selenbp1 UTSW 3 94940114 missense probably benign 0.10
R9145:Selenbp1 UTSW 3 94944103 missense probably benign 0.38
R9209:Selenbp1 UTSW 3 94939768 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGGAACTCCATCTGTACCCC -3'
(R):5'- TGCTCTACAGATCTCGCTGG -3'

Sequencing Primer
(F):5'- TACAGATGGCCCACGGAC -3'
(R):5'- TACAGATCTCGCTGGTCTCAGAG -3'
Posted On 2021-04-30