Incidental Mutation 'R8803:Ugt2a3'
ID671611
Institutional Source Beutler Lab
Gene Symbol Ugt2a3
Ensembl Gene ENSMUSG00000035780
Gene NameUDP glucuronosyltransferase 2 family, polypeptide A3
Synonyms2010321J07Rik
Accession Numbers

Genbank: NM_028094; MGI: 1919344

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8803 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location87324972-87337195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87336530 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 212 (K212E)
Ref Sequence ENSEMBL: ENSMUSP00000031195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031195]
Predicted Effect probably damaging
Transcript: ENSMUST00000031195
AA Change: K212E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031195
Gene: ENSMUSG00000035780
AA Change: K212E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:UDPGT 24 526 1.2e-233 PFAM
Pfam:Glyco_tran_28_C 318 454 1.5e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,545,256 S431T probably benign Het
Acot7 T G 4: 152,217,815 V128G probably damaging Het
Actn3 T C 19: 4,864,663 D508G probably benign Het
Adam18 T C 8: 24,647,862 I321V probably benign Het
Ak1 T C 2: 32,633,478 V186A probably benign Het
Aldh3a2 A G 11: 61,248,930 F459L probably benign Het
Atp11a T C 8: 12,825,721 L256P probably benign Het
Bcan T C 3: 87,996,692 E162G probably benign Het
Birc6 A G 17: 74,652,038 Q3850R probably damaging Het
Btla A G 16: 45,239,067 T45A probably benign Het
Cad T G 5: 31,069,564 S1222A probably damaging Het
Cbarp A G 10: 80,137,142 V39A possibly damaging Het
Cct2 A C 10: 117,058,185 D221E probably benign Het
Cmya5 T C 13: 93,041,483 D3621G probably damaging Het
Col20a1 G T 2: 181,001,338 R867L possibly damaging Het
Cops3 A G 11: 59,827,976 V164A probably benign Het
Crygf A G 1: 65,927,989 R91G probably damaging Het
Csmd2 T A 4: 128,546,684 S3181T Het
Cyb5r1 G T 1: 134,405,958 probably benign Het
Dennd6b T A 15: 89,186,180 I429F probably benign Het
Dock1 A G 7: 134,874,087 T864A probably benign Het
Eea1 A T 10: 96,023,991 D713V probably benign Het
Fam78b G A 1: 167,001,591 C9Y probably damaging Het
Gga2 A C 7: 121,997,779 D371E probably benign Het
Gtpbp6 A T 5: 110,107,320 V2E unknown Het
Hectd4 A T 5: 121,323,931 M954L probably benign Het
Hmcn1 A G 1: 150,734,497 C1474R probably damaging Het
Igkv1-99 G T 6: 68,542,386 G109V Het
Izumo3 T C 4: 92,145,073 probably null Het
Kremen1 T C 11: 5,194,981 D465G probably benign Het
Ksr1 T C 11: 79,146,056 E75G probably benign Het
Mmp17 G T 5: 129,598,709 E311* probably null Het
Mmrn1 T A 6: 60,988,287 F1101I probably damaging Het
Muc13 G A 16: 33,812,917 probably benign Het
Myl4 T A 11: 104,584,577 M147K probably damaging Het
Myo1a T A 10: 127,710,987 N334K probably benign Het
Myo3b T C 2: 70,252,994 S664P probably benign Het
Nptxr T C 15: 79,794,454 N211D probably damaging Het
Ntf5 A G 7: 45,416,061 T206A probably benign Het
Obscn T A 11: 59,054,403 E4596D probably benign Het
Olfr1316 T C 2: 112,130,082 H243R probably damaging Het
Olfr1426 T C 19: 12,088,105 E229G probably benign Het
Olfr1469 A T 19: 13,410,673 I35F probably damaging Het
Olfr860 A T 9: 19,846,166 I151N possibly damaging Het
Olfr988 T A 2: 85,353,734 Q64L probably damaging Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Paip2 A G 18: 35,616,220 N114D possibly damaging Het
Pcnx T C 12: 81,993,151 S2071P possibly damaging Het
Pcsk2 A G 2: 143,795,950 T369A probably damaging Het
Ppp1r12b A C 1: 134,890,754 probably benign Het
Ppp1r35 T A 5: 137,779,469 D132E possibly damaging Het
Pramel7 A T 2: 87,490,061 V296E probably benign Het
Prh1 C T 6: 132,571,985 P152S unknown Het
Pygl T C 12: 70,195,616 T689A probably damaging Het
Rasgef1b T C 5: 99,221,410 S450G probably benign Het
Rtn4ip1 G T 10: 43,907,846 R121L probably damaging Het
Scarf2 A T 16: 17,802,831 H121L probably damaging Het
Selenbp1 C A 3: 94,944,510 A454E possibly damaging Het
Slc7a9 A G 7: 35,463,718 I449M possibly damaging Het
Snapc2 C T 8: 4,255,558 H278Y probably damaging Het
Stambp C T 6: 83,547,230 probably null Het
Syne1 T C 10: 5,361,535 Y550C probably damaging Het
Tas2r113 T C 6: 132,893,141 V44A possibly damaging Het
Trpv4 T C 5: 114,634,755 T305A probably benign Het
Twf1 T C 15: 94,581,255 Y241C probably damaging Het
Ush2a A T 1: 188,944,801 H4770L probably benign Het
Zfc3h1 T C 10: 115,411,895 V1001A probably benign Het
Zfp335 C T 2: 164,909,370 R92Q probably benign Het
Other mutations in Ugt2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ugt2a3 APN 5 87325655 missense probably damaging 0.99
IGL00542:Ugt2a3 APN 5 87336823 missense possibly damaging 0.61
IGL01335:Ugt2a3 APN 5 87336785 missense probably damaging 1.00
IGL01369:Ugt2a3 APN 5 87327120 missense probably damaging 1.00
IGL01808:Ugt2a3 APN 5 87325555 missense probably benign 0.09
IGL02380:Ugt2a3 APN 5 87336799 missense probably benign 0.09
IGL03245:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03260:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03261:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03280:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03302:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
D4186:Ugt2a3 UTSW 5 87329613 missense probably damaging 1.00
R0051:Ugt2a3 UTSW 5 87337006 missense probably damaging 1.00
R0103:Ugt2a3 UTSW 5 87336718 missense possibly damaging 0.89
R0103:Ugt2a3 UTSW 5 87336718 missense possibly damaging 0.89
R0324:Ugt2a3 UTSW 5 87327073 critical splice donor site probably null
R0401:Ugt2a3 UTSW 5 87336490 missense probably benign 0.03
R0506:Ugt2a3 UTSW 5 87336649 missense possibly damaging 0.78
R0903:Ugt2a3 UTSW 5 87327711 missense probably benign 0.00
R0940:Ugt2a3 UTSW 5 87327206 missense possibly damaging 0.95
R1121:Ugt2a3 UTSW 5 87327689 missense probably damaging 0.99
R1296:Ugt2a3 UTSW 5 87327146 missense probably damaging 0.96
R1527:Ugt2a3 UTSW 5 87325598 missense probably damaging 1.00
R2104:Ugt2a3 UTSW 5 87329682 splice site probably null
R2119:Ugt2a3 UTSW 5 87336571 missense probably damaging 0.98
R2374:Ugt2a3 UTSW 5 87327191 missense probably damaging 1.00
R3082:Ugt2a3 UTSW 5 87325675 missense probably benign 0.05
R3853:Ugt2a3 UTSW 5 87337159 missense possibly damaging 0.74
R3894:Ugt2a3 UTSW 5 87329590 missense probably benign 0.09
R4063:Ugt2a3 UTSW 5 87336866 missense probably benign 0.04
R4274:Ugt2a3 UTSW 5 87327689 missense probably damaging 0.99
R4739:Ugt2a3 UTSW 5 87327195 missense probably damaging 0.97
R4879:Ugt2a3 UTSW 5 87331285 missense probably benign 0.06
R5327:Ugt2a3 UTSW 5 87331315 missense probably damaging 1.00
R5508:Ugt2a3 UTSW 5 87327200 missense probably damaging 0.98
R5866:Ugt2a3 UTSW 5 87336547 missense probably damaging 1.00
R6026:Ugt2a3 UTSW 5 87336477 missense probably benign 0.00
R6268:Ugt2a3 UTSW 5 87329613 missense probably damaging 1.00
R6807:Ugt2a3 UTSW 5 87336758 missense probably benign 0.00
R6980:Ugt2a3 UTSW 5 87325632 missense probably damaging 1.00
R7056:Ugt2a3 UTSW 5 87337094 missense probably damaging 0.98
R7133:Ugt2a3 UTSW 5 87325534 missense possibly damaging 0.61
R7477:Ugt2a3 UTSW 5 87336620 missense possibly damaging 0.90
R7485:Ugt2a3 UTSW 5 87327680 critical splice donor site probably null
R7798:Ugt2a3 UTSW 5 87327723 missense probably damaging 1.00
R7957:Ugt2a3 UTSW 5 87327191 missense probably damaging 1.00
R8886:Ugt2a3 UTSW 5 87336499 missense probably damaging 1.00
R8944:Ugt2a3 UTSW 5 87325558 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CAAAAGGACTTCATTTTGCCTCTC -3'
(R):5'- ATAGACCCTGTCGTTCCCTGTG -3'

Sequencing Primer
(F):5'- ACTTTCACATGTAGAGTTTTACACG -3'
(R):5'- CCTGTCGTTCCCTGTGGAGAG -3'
Posted On2021-04-30