Incidental Mutation 'R8803:Mmrn1'
ID 671618
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Name multimerin 1
Synonyms 4921530G03Rik, Emilin4
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8803 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 60924976-60989378 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 60988287 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1101 (F1101I)
Ref Sequence ENSEMBL: ENSMUSP00000119609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000129603
AA Change: F1101I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: F1101I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204333
AA Change: F1100I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: F1100I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,545,256 S431T probably benign Het
Acot7 T G 4: 152,217,815 V128G probably damaging Het
Actn3 T C 19: 4,864,663 D508G probably benign Het
Adam18 T C 8: 24,647,862 I321V probably benign Het
Ak1 T C 2: 32,633,478 V186A probably benign Het
Aldh3a2 A G 11: 61,248,930 F459L probably benign Het
Atp11a T C 8: 12,825,721 L256P probably benign Het
Bcan T C 3: 87,996,692 E162G probably benign Het
Birc6 A G 17: 74,652,038 Q3850R probably damaging Het
Btf3l4 T G 4: 108,831,887 probably benign Het
Btla A G 16: 45,239,067 T45A probably benign Het
Cad T G 5: 31,069,564 S1222A probably damaging Het
Cbarp A G 10: 80,137,142 V39A possibly damaging Het
Cct2 A C 10: 117,058,185 D221E probably benign Het
Cmya5 T C 13: 93,041,483 D3621G probably damaging Het
Col20a1 G T 2: 181,001,338 R867L possibly damaging Het
Cops3 A G 11: 59,827,976 V164A probably benign Het
Crygf A G 1: 65,927,989 R91G probably damaging Het
Csmd2 T A 4: 128,546,684 S3181T Het
Cyb5r1 G T 1: 134,405,958 probably benign Het
Dennd6b T A 15: 89,186,180 I429F probably benign Het
Dock1 A G 7: 134,874,087 T864A probably benign Het
Eea1 A T 10: 96,023,991 D713V probably benign Het
Fam78b G A 1: 167,001,591 C9Y probably damaging Het
Gga2 A C 7: 121,997,779 D371E probably benign Het
Gtpbp6 A T 5: 110,107,320 V2E unknown Het
Hectd4 A T 5: 121,323,931 M954L probably benign Het
Hmcn1 A G 1: 150,734,497 C1474R probably damaging Het
Igkv1-99 G T 6: 68,542,386 G109V Het
Izumo3 T C 4: 92,145,073 probably null Het
Kremen1 T C 11: 5,194,981 D465G probably benign Het
Ksr1 T C 11: 79,146,056 E75G probably benign Het
Mmp17 G T 5: 129,598,709 E311* probably null Het
Muc13 G A 16: 33,812,917 probably benign Het
Myl4 T A 11: 104,584,577 M147K probably damaging Het
Myo1a T A 10: 127,710,987 N334K probably benign Het
Myo3b T C 2: 70,252,994 S664P probably benign Het
Nptxr T C 15: 79,794,454 N211D probably damaging Het
Ntf5 A G 7: 45,416,061 T206A probably benign Het
Obscn T A 11: 59,054,403 E4596D probably benign Het
Olfr1316 T C 2: 112,130,082 H243R probably damaging Het
Olfr1426 T C 19: 12,088,105 E229G probably benign Het
Olfr1469 A T 19: 13,410,673 I35F probably damaging Het
Olfr860 A T 9: 19,846,166 I151N possibly damaging Het
Olfr988 T A 2: 85,353,734 Q64L probably damaging Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Paip2 A G 18: 35,616,220 N114D possibly damaging Het
Pcnx T C 12: 81,993,151 S2071P possibly damaging Het
Pcsk2 A G 2: 143,795,950 T369A probably damaging Het
Ppp1r12b A C 1: 134,890,754 probably benign Het
Ppp1r35 T A 5: 137,779,469 D132E possibly damaging Het
Pramel7 A T 2: 87,490,061 V296E probably benign Het
Prh1 C T 6: 132,571,985 P152S unknown Het
Pygl T C 12: 70,195,616 T689A probably damaging Het
Rasgef1b T C 5: 99,221,410 S450G probably benign Het
Rtn4ip1 G T 10: 43,907,846 R121L probably damaging Het
Scarf2 A T 16: 17,802,831 H121L probably damaging Het
Selenbp1 C A 3: 94,944,510 A454E possibly damaging Het
Slc7a9 A G 7: 35,463,718 I449M possibly damaging Het
Snapc2 C T 8: 4,255,558 H278Y probably damaging Het
Stambp C T 6: 83,547,230 probably null Het
Syne1 T C 10: 5,361,535 Y550C probably damaging Het
Tas2r113 T C 6: 132,893,141 V44A possibly damaging Het
Trpv4 T C 5: 114,634,755 T305A probably benign Het
Twf1 T C 15: 94,581,255 Y241C probably damaging Het
Ugt2a3 T C 5: 87,336,530 K212E probably damaging Het
Ush2a A T 1: 188,944,801 H4770L probably benign Het
Zfc3h1 T C 10: 115,411,895 V1001A probably benign Het
Zfp335 C T 2: 164,909,370 R92Q probably benign Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60977513 missense probably benign
IGL00742:Mmrn1 APN 6 60958120 missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60975910 nonsense probably null
IGL01121:Mmrn1 APN 6 60975944 missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60960708 splice site probably benign
IGL01697:Mmrn1 APN 6 60976493 missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60977161 missense probably benign
IGL01944:Mmrn1 APN 6 60971183 critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60944573 missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60960744 missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60987193 missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60977147 missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60944822 missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60958176 missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60973046 missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60976340 missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60944892 missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60988435 missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60975835 missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60976033 missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60973010 missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60975815 splice site probably benign
R0352:Mmrn1 UTSW 6 60944971 missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60977115 missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60976469 missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60973119 missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60976325 missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60976322 missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60945118 missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60944771 nonsense probably null
R1599:Mmrn1 UTSW 6 60945037 missense probably benign
R1733:Mmrn1 UTSW 6 60977101 missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60976084 missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60944805 missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60945075 missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60976441 missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60944847 missense probably benign
R3837:Mmrn1 UTSW 6 60944847 missense probably benign
R4206:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60944586 missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60960813 missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60988473 missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60973043 missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60976439 missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60976490 missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60976586 missense probably damaging 1.00
R5887:Mmrn1 UTSW 6 60987074 missense probably benign
R5917:Mmrn1 UTSW 6 60973150 critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60975976 missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60987184 missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60977383 missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60988540 nonsense probably null
R7073:Mmrn1 UTSW 6 60988427 missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60944543 start gained probably benign
R7256:Mmrn1 UTSW 6 60976114 missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60944933 nonsense probably null
R7350:Mmrn1 UTSW 6 60976336 nonsense probably null
R7388:Mmrn1 UTSW 6 60976252 missense probably benign 0.43
R7652:Mmrn1 UTSW 6 60977506 missense probably benign 0.14
R7664:Mmrn1 UTSW 6 60976705 missense probably benign 0.44
R7810:Mmrn1 UTSW 6 60976325 missense probably benign 0.18
R7832:Mmrn1 UTSW 6 60987060 splice site probably null
R7979:Mmrn1 UTSW 6 60975977 missense probably damaging 0.96
R8071:Mmrn1 UTSW 6 60944524 start gained probably benign
R8130:Mmrn1 UTSW 6 60960723 missense probably damaging 1.00
R8277:Mmrn1 UTSW 6 60977236 missense probably benign 0.19
R8353:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8453:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8472:Mmrn1 UTSW 6 60988396 missense probably damaging 1.00
R8758:Mmrn1 UTSW 6 60987209 missense possibly damaging 0.54
R8879:Mmrn1 UTSW 6 60976529 missense probably damaging 0.99
R8907:Mmrn1 UTSW 6 60976093 missense probably damaging 1.00
R8983:Mmrn1 UTSW 6 60976058 missense probably benign 0.04
R9200:Mmrn1 UTSW 6 60976876 missense probably damaging 1.00
R9287:Mmrn1 UTSW 6 60975955 missense probably damaging 1.00
R9387:Mmrn1 UTSW 6 60958192 nonsense probably null
R9612:Mmrn1 UTSW 6 60976424 missense probably damaging 0.96
R9674:Mmrn1 UTSW 6 60971088 nonsense probably null
X0026:Mmrn1 UTSW 6 60976013 missense probably benign 0.09
Z1176:Mmrn1 UTSW 6 60945034 missense probably benign 0.37
Z1177:Mmrn1 UTSW 6 60987098 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACAGGGGCATCACTCAGTTTG -3'
(R):5'- GTCACAGTGTATCTCATTGTCAGC -3'

Sequencing Primer
(F):5'- GCATCACTCAGTTTGATAGAGAGC -3'
(R):5'- GTGTATCTCATTGTCAGCATTTTCAG -3'
Posted On 2021-04-30