Incidental Mutation 'R8803:Twf1'
ID 671650
Institutional Source Beutler Lab
Gene Symbol Twf1
Ensembl Gene ENSMUSG00000022451
Gene Name twinfilin actin binding protein 1
Synonyms twinfilin, actin monomer-binding protein, Twinfilin-1, Ptk9, A6
MMRRC Submission 068640-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8803 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 94475829-94487727 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94479136 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 241 (Y241C)
Ref Sequence ENSEMBL: ENSMUSP00000023087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023087] [ENSMUST00000109248] [ENSMUST00000152590]
AlphaFold Q91YR1
PDB Structure CRYSTAL STRUCTURE OF THE N-TERMINAL ADF-H DOMAIN OF MOUSE TWINFILIN ISOFORM-1 [X-RAY DIFFRACTION]
Solution structure of the second tandem cofilin-domain of mouse twinfilin [SOLUTION NMR]
Solution structure of C-teminal domain of twinfilin-1. [SOLUTION NMR]
Structure of the actin-depolymerizing factor homology domain in complex with actin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000023087
AA Change: Y241C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023087
Gene: ENSMUSG00000022451
AA Change: Y241C

DomainStartEndE-ValueType
ADF 11 139 4.74e-35 SMART
ADF 184 313 6.22e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109248
SMART Domains Protein: ENSMUSP00000104871
Gene: ENSMUSG00000059883

DomainStartEndE-ValueType
Pfam:Death 20 101 1.6e-6 PFAM
Pfam:Pkinase_Tyr 187 452 1.9e-51 PFAM
Pfam:Pkinase 188 452 1.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152590
SMART Domains Protein: ENSMUSP00000119302
Gene: ENSMUSG00000022451

DomainStartEndE-ValueType
ADF 1 113 1.9e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes twinfilin, an actin monomer-binding protein conserved from yeast to mammals. Studies of the mouse counterpart suggest that this protein may be an actin monomer-binding protein, and its localization to cortical G-actin-rich structures may be regulated by the small GTPase RAC1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,998,290 (GRCm39) S431T probably benign Het
Acot7 T G 4: 152,302,272 (GRCm39) V128G probably damaging Het
Actn3 T C 19: 4,914,691 (GRCm39) D508G probably benign Het
Adam18 T C 8: 25,137,878 (GRCm39) I321V probably benign Het
Ak1 T C 2: 32,523,490 (GRCm39) V186A probably benign Het
Aldh3a2 A G 11: 61,139,756 (GRCm39) F459L probably benign Het
Atp11a T C 8: 12,875,721 (GRCm39) L256P probably benign Het
Bcan T C 3: 87,903,999 (GRCm39) E162G probably benign Het
Birc6 A G 17: 74,959,033 (GRCm39) Q3850R probably damaging Het
Btf3l4 T G 4: 108,689,084 (GRCm39) probably benign Het
Btla A G 16: 45,059,430 (GRCm39) T45A probably benign Het
Cad T G 5: 31,226,908 (GRCm39) S1222A probably damaging Het
Cbarp A G 10: 79,972,976 (GRCm39) V39A possibly damaging Het
Cct2 A C 10: 116,894,090 (GRCm39) D221E probably benign Het
Cmya5 T C 13: 93,177,991 (GRCm39) D3621G probably damaging Het
Col20a1 G T 2: 180,643,131 (GRCm39) R867L possibly damaging Het
Cops3 A G 11: 59,718,802 (GRCm39) V164A probably benign Het
Crygf A G 1: 65,967,148 (GRCm39) R91G probably damaging Het
Csmd2 T A 4: 128,440,477 (GRCm39) S3181T Het
Cyb5r1 G T 1: 134,333,696 (GRCm39) probably benign Het
Dennd6b T A 15: 89,070,383 (GRCm39) I429F probably benign Het
Dock1 A G 7: 134,475,816 (GRCm39) T864A probably benign Het
Eea1 A T 10: 95,859,853 (GRCm39) D713V probably benign Het
Fam78b G A 1: 166,829,160 (GRCm39) C9Y probably damaging Het
Gga2 A C 7: 121,597,002 (GRCm39) D371E probably benign Het
Gtpbp6 A T 5: 110,255,186 (GRCm39) V2E unknown Het
Hectd4 A T 5: 121,461,994 (GRCm39) M954L probably benign Het
Hmcn1 A G 1: 150,610,248 (GRCm39) C1474R probably damaging Het
Igkv1-99 G T 6: 68,519,370 (GRCm39) G109V Het
Izumo3 T C 4: 92,033,310 (GRCm39) probably null Het
Kremen1 T C 11: 5,144,981 (GRCm39) D465G probably benign Het
Ksr1 T C 11: 79,036,882 (GRCm39) E75G probably benign Het
Mmp17 G T 5: 129,675,773 (GRCm39) E311* probably null Het
Mmrn1 T A 6: 60,965,271 (GRCm39) F1101I probably damaging Het
Muc13 G A 16: 33,633,287 (GRCm39) probably benign Het
Myl4 T A 11: 104,475,403 (GRCm39) M147K probably damaging Het
Myo1a T A 10: 127,546,856 (GRCm39) N334K probably benign Het
Myo3b T C 2: 70,083,338 (GRCm39) S664P probably benign Het
Nptxr T C 15: 79,678,655 (GRCm39) N211D probably damaging Het
Ntf5 A G 7: 45,065,485 (GRCm39) T206A probably benign Het
Obscn T A 11: 58,945,229 (GRCm39) E4596D probably benign Het
Or4d10c T C 19: 12,065,469 (GRCm39) E229G probably benign Het
Or4f14d T C 2: 111,960,427 (GRCm39) H243R probably damaging Het
Or5ak20 T A 2: 85,184,078 (GRCm39) Q64L probably damaging Het
Or5ak25 T A 2: 85,268,981 (GRCm39) I174F probably damaging Het
Or5b3 A T 19: 13,388,037 (GRCm39) I35F probably damaging Het
Or7e169 A T 9: 19,757,462 (GRCm39) I151N possibly damaging Het
Paip2 A G 18: 35,749,273 (GRCm39) N114D possibly damaging Het
Pcnx1 T C 12: 82,039,925 (GRCm39) S2071P possibly damaging Het
Pcsk2 A G 2: 143,637,870 (GRCm39) T369A probably damaging Het
Ppp1r12b A C 1: 134,818,492 (GRCm39) probably benign Het
Ppp1r35 T A 5: 137,777,731 (GRCm39) D132E possibly damaging Het
Pramel7 A T 2: 87,320,405 (GRCm39) V296E probably benign Het
Prh1 C T 6: 132,548,948 (GRCm39) P152S unknown Het
Pygl T C 12: 70,242,390 (GRCm39) T689A probably damaging Het
Rasgef1b T C 5: 99,369,269 (GRCm39) S450G probably benign Het
Rtn4ip1 G T 10: 43,783,842 (GRCm39) R121L probably damaging Het
Scarf2 A T 16: 17,620,695 (GRCm39) H121L probably damaging Het
Selenbp1 C A 3: 94,851,821 (GRCm39) A454E possibly damaging Het
Slc7a9 A G 7: 35,163,143 (GRCm39) I449M possibly damaging Het
Snapc2 C T 8: 4,305,558 (GRCm39) H278Y probably damaging Het
Stambp C T 6: 83,524,212 (GRCm39) probably null Het
Syne1 T C 10: 5,311,535 (GRCm39) Y550C probably damaging Het
Tas2r113 T C 6: 132,870,104 (GRCm39) V44A possibly damaging Het
Trpv4 T C 5: 114,772,816 (GRCm39) T305A probably benign Het
Ugt2a3 T C 5: 87,484,389 (GRCm39) K212E probably damaging Het
Ush2a A T 1: 188,676,998 (GRCm39) H4770L probably benign Het
Zfc3h1 T C 10: 115,247,800 (GRCm39) V1001A probably benign Het
Zfp335 C T 2: 164,751,290 (GRCm39) R92Q probably benign Het
Other mutations in Twf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Twf1 APN 15 94,478,817 (GRCm39) unclassified probably benign
IGL02732:Twf1 APN 15 94,478,890 (GRCm39) missense probably damaging 1.00
R0122:Twf1 UTSW 15 94,484,430 (GRCm39) splice site probably benign
R0184:Twf1 UTSW 15 94,478,948 (GRCm39) critical splice acceptor site probably null
R0507:Twf1 UTSW 15 94,483,411 (GRCm39) missense probably damaging 1.00
R0742:Twf1 UTSW 15 94,483,411 (GRCm39) missense probably damaging 1.00
R1200:Twf1 UTSW 15 94,484,239 (GRCm39) missense probably benign 0.05
R1858:Twf1 UTSW 15 94,483,428 (GRCm39) splice site probably benign
R2005:Twf1 UTSW 15 94,483,328 (GRCm39) critical splice donor site probably null
R2290:Twf1 UTSW 15 94,484,400 (GRCm39) missense probably damaging 0.98
R3732:Twf1 UTSW 15 94,482,295 (GRCm39) unclassified probably benign
R4787:Twf1 UTSW 15 94,482,315 (GRCm39) missense probably damaging 1.00
R7782:Twf1 UTSW 15 94,480,654 (GRCm39) missense probably benign 0.05
R7893:Twf1 UTSW 15 94,482,327 (GRCm39) missense probably benign 0.00
R8177:Twf1 UTSW 15 94,482,276 (GRCm39) missense possibly damaging 0.75
R8415:Twf1 UTSW 15 94,477,702 (GRCm39) makesense probably null
R8729:Twf1 UTSW 15 94,479,212 (GRCm39) missense probably benign
R8768:Twf1 UTSW 15 94,479,110 (GRCm39) missense probably damaging 1.00
R9150:Twf1 UTSW 15 94,484,274 (GRCm39) missense probably damaging 1.00
R9378:Twf1 UTSW 15 94,483,336 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACGTGTATCCAGGCATC -3'
(R):5'- GTACATCATCTTTGACTCTCATCTAAG -3'

Sequencing Primer
(F):5'- TCCAGGCATCGAATAAATAAAAACTG -3'
(R):5'- CCTGTTTCACAAGTGCTGT -3'
Posted On 2021-04-30