Incidental Mutation 'R8758:Vwa3b'
ID671722
Institutional Source Beutler Lab
Gene Symbol Vwa3b
Ensembl Gene ENSMUSG00000050122
Gene Namevon Willebrand factor A domain containing 3B
Synonyms4921511C04Rik, A230074B11Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: XM_003084438.1; MGI:1918103

Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8758 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location37026596-37187613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37137792 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 40 (D40G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027289]
AlphaFold A0A571BE33
Predicted Effect probably benign
Transcript: ENSMUST00000027289
SMART Domains Protein: ENSMUSP00000027289
Gene: ENSMUSG00000050122

DomainStartEndE-ValueType
Pfam:DUF4537 159 285 9.1e-36 PFAM
low complexity region 327 336 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI

All alleles(71) : Targeted(3) Gene trapped(68)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik G A 4: 39,450,811 D6N probably benign Het
AC157566.4 T C 15: 76,534,182 I42M probably benign Het
Amer2 C T 14: 60,378,877 R174C probably damaging Het
Arl8a A T 1: 135,154,451 D139V possibly damaging Het
Csmd3 A G 15: 47,606,197 Y2525H Het
Cwc22 T C 2: 77,917,097 E424G possibly damaging Het
D930048N14Rik A G 11: 51,653,741 T80A unknown Het
Ddx25 T A 9: 35,542,004 E483D probably benign Het
Dock4 A T 12: 40,788,232 E1057D probably benign Het
Dock7 C T 4: 99,061,318 R429Q Het
Dzip3 T C 16: 48,977,937 Y135C probably damaging Het
Evi5l G T 8: 4,205,860 A618S probably benign Het
Fibp A G 19: 5,464,942 D348G possibly damaging Het
Gimd1 T A 3: 132,635,038 L105H probably damaging Het
Glra1 T A 11: 55,527,365 I268F possibly damaging Het
Gm30191 A G 4: 134,249,788 T104A probably benign Het
Gm49359 A T 13: 62,454,336 I350K possibly damaging Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
Igkv4-74 AG A 6: 69,185,327 probably null Het
Ikzf1 A G 11: 11,761,359 S198G probably benign Het
Kcna4 T A 2: 107,296,149 D409E probably damaging Het
Lipt2 GGCGCCCGCGCGCG GGCG 7: 100,159,681 probably null Het
Mgam T A 6: 40,729,043 D15E probably benign Het
Mmrn1 A G 6: 60,987,209 D1065G possibly damaging Het
Plxnc1 A C 10: 94,922,745 V363G possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Psg21 T C 7: 18,650,753 Y356C probably damaging Het
Ranbp1 T C 16: 18,241,795 D130G probably damaging Het
Rb1cc1 A T 1: 6,240,227 Q283L probably benign Het
Rph3a A T 5: 120,959,302 H250Q probably benign Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Skil C T 3: 31,118,537 A605V probably damaging Het
Slc28a3 T C 13: 58,572,610 T312A probably benign Het
Ssh2 T A 11: 77,454,017 C943S probably benign Het
Tgfbi C T 13: 56,632,081 A481V probably damaging Het
Tgfbr3 G A 5: 107,149,884 P217S probably damaging Het
Tmem135 A T 7: 89,305,513 W99R probably benign Het
Tmx1 A G 12: 70,456,014 Y52C possibly damaging Het
Ube3b A T 5: 114,415,200 probably benign Het
Vmn2r57 G T 7: 41,428,739 N98K probably damaging Het
Zfyve26 A G 12: 79,264,309 probably benign Het
Other mutations in Vwa3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Vwa3b APN 1 37154036 missense probably benign 0.28
IGL02236:Vwa3b APN 1 37154051 splice site probably benign
IGL02653:Vwa3b APN 1 37175565 utr 3 prime probably benign
IGL02823:Vwa3b APN 1 37186904 utr 3 prime probably benign
IGL03030:Vwa3b APN 1 37044968 missense probably damaging 1.00
P0014:Vwa3b UTSW 1 37173914 utr 3 prime probably benign
R0035:Vwa3b UTSW 1 37165689 missense possibly damaging 0.69
R0102:Vwa3b UTSW 1 37135514 missense probably damaging 1.00
R0556:Vwa3b UTSW 1 37164485 splice site probably benign
R1061:Vwa3b UTSW 1 37157430 missense probably damaging 1.00
R1386:Vwa3b UTSW 1 37051881 critical splice donor site probably null
R2441:Vwa3b UTSW 1 37143069 unclassified probably benign
R3117:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R3119:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R4081:Vwa3b UTSW 1 37035824 missense probably damaging 0.99
R4393:Vwa3b UTSW 1 37045178 missense probably damaging 1.00
R4897:Vwa3b UTSW 1 37114603 splice site probably benign
R4950:Vwa3b UTSW 1 37085332 missense probably benign 0.00
R4978:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5141:Vwa3b UTSW 1 37187021 utr 3 prime probably benign
R5286:Vwa3b UTSW 1 37045039 missense probably damaging 1.00
R5356:Vwa3b UTSW 1 37114583 missense probably damaging 0.99
R5426:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5480:Vwa3b UTSW 1 37100706 nonsense probably null
R5727:Vwa3b UTSW 1 37135519 missense probably benign 0.10
R5876:Vwa3b UTSW 1 37076439 missense probably damaging 0.97
R6191:Vwa3b UTSW 1 37114531 missense possibly damaging 0.92
R6219:Vwa3b UTSW 1 37100698 missense possibly damaging 0.92
R6250:Vwa3b UTSW 1 37051885 splice site probably null
R6281:Vwa3b UTSW 1 37123982 missense probably damaging 1.00
R6419:Vwa3b UTSW 1 37157376 missense probably benign 0.01
R6467:Vwa3b UTSW 1 37085286 missense probably benign 0.01
R6512:Vwa3b UTSW 1 37063642 intron probably benign
R6541:Vwa3b UTSW 1 37051761 missense probably damaging 1.00
R6724:Vwa3b UTSW 1 37045031 missense probably damaging 1.00
R6728:Vwa3b UTSW 1 37157372 missense probably damaging 1.00
R7046:Vwa3b UTSW 1 37173878 missense probably benign
R7117:Vwa3b UTSW 1 37135553 missense
R7304:Vwa3b UTSW 1 37164505 missense probably damaging 1.00
R7402:Vwa3b UTSW 1 37114597 nonsense probably null
R7762:Vwa3b UTSW 1 37124045 missense probably damaging 1.00
R7911:Vwa3b UTSW 1 37154026 missense probably damaging 1.00
R8213:Vwa3b UTSW 1 37128939 missense probably benign 0.07
R8402:Vwa3b UTSW 1 37165798 missense probably damaging 1.00
R8697:Vwa3b UTSW 1 37076380 missense probably benign 0.09
R8874:Vwa3b UTSW 1 37035758 missense possibly damaging 0.73
R9011:Vwa3b UTSW 1 37115686 missense probably damaging 1.00
R9012:Vwa3b UTSW 1 37085310 missense probably benign 0.15
R9015:Vwa3b UTSW 1 37164516 missense possibly damaging 0.71
R9102:Vwa3b UTSW 1 37135512 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GCTCAGGTCTTCAAGTCTGTAG -3'
(R):5'- CTTGCCAGGAATGAGCAAGAC -3'

Sequencing Primer
(F):5'- CTCAGGTCTTCAAGTCTGTAGTGTTC -3'
(R):5'- GGGTTTTAAAAGGACTCCCATG -3'
Posted On2021-04-30