Incidental Mutation 'R8758:Rph3a'
ID671734
Institutional Source Beutler Lab
Gene Symbol Rph3a
Ensembl Gene ENSMUSG00000029608
Gene Namerabphilin 3A
Synonyms2900002P20Rik, Doc2 family
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8758 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location120940499-121010092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120959302 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 250 (H250Q)
Ref Sequence ENSEMBL: ENSMUSP00000078198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079204] [ENSMUST00000202326] [ENSMUST00000202406]
PDB Structure Structural determinants for Ca2+ and PIP2 binding by the C2A domain of rabphilin-3A [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000079204
AA Change: H250Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078198
Gene: ENSMUSG00000029608
AA Change: H250Q

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202326
AA Change: H250Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144291
Gene: ENSMUSG00000029608
AA Change: H250Q

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202406
AA Change: H250Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143917
Gene: ENSMUSG00000029608
AA Change: H250Q

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an effector for RAB3A, which is a small G protein that acts in the late stages of neurotransmitter exocytosis. The encoded protein may be involved in neurotransmitter release and synaptic vesicle traffic. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous mutants are viable and fertile and do not exhibit any obvious abnormal phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik G A 4: 39,450,811 D6N probably benign Het
AC157566.4 T C 15: 76,534,182 I42M probably benign Het
Amer2 C T 14: 60,378,877 R174C probably damaging Het
Arl8a A T 1: 135,154,451 D139V possibly damaging Het
Csmd3 A G 15: 47,606,197 Y2525H Het
Cwc22 T C 2: 77,917,097 E424G possibly damaging Het
D930048N14Rik A G 11: 51,653,741 T80A unknown Het
Ddx25 T A 9: 35,542,004 E483D probably benign Het
Dock4 A T 12: 40,788,232 E1057D probably benign Het
Dock7 C T 4: 99,061,318 R429Q Het
Dzip3 T C 16: 48,977,937 Y135C probably damaging Het
Evi5l G T 8: 4,205,860 A618S probably benign Het
Fibp A G 19: 5,464,942 D348G possibly damaging Het
Gimd1 T A 3: 132,635,038 L105H probably damaging Het
Glra1 T A 11: 55,527,365 I268F possibly damaging Het
Gm30191 A G 4: 134,249,788 T104A probably benign Het
Gm49359 A T 13: 62,454,336 I350K possibly damaging Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
Igkv4-74 AG A 6: 69,185,327 probably null Het
Ikzf1 A G 11: 11,761,359 S198G probably benign Het
Kcna4 T A 2: 107,296,149 D409E probably damaging Het
Lipt2 GGCGCCCGCGCGCG GGCG 7: 100,159,681 probably null Het
Mgam T A 6: 40,729,043 D15E probably benign Het
Mmrn1 A G 6: 60,987,209 D1065G possibly damaging Het
Plxnc1 A C 10: 94,922,745 V363G possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Psg21 T C 7: 18,650,753 Y356C probably damaging Het
Ranbp1 T C 16: 18,241,795 D130G probably damaging Het
Rb1cc1 A T 1: 6,240,227 Q283L probably benign Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Skil C T 3: 31,118,537 A605V probably damaging Het
Slc28a3 T C 13: 58,572,610 T312A probably benign Het
Ssh2 T A 11: 77,454,017 C943S probably benign Het
Tgfbi C T 13: 56,632,081 A481V probably damaging Het
Tgfbr3 G A 5: 107,149,884 P217S probably damaging Het
Tmem135 A T 7: 89,305,513 W99R probably benign Het
Tmx1 A G 12: 70,456,014 Y52C possibly damaging Het
Ube3b A T 5: 114,415,200 probably benign Het
Vmn2r57 G T 7: 41,428,739 N98K probably damaging Het
Vwa3b A G 1: 37,137,792 D40G Het
Zfyve26 A G 12: 79,264,309 probably benign Het
Other mutations in Rph3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02281:Rph3a APN 5 120948833 missense probably damaging 1.00
IGL02383:Rph3a APN 5 120963939 missense probably damaging 1.00
IGL02394:Rph3a APN 5 120946348 splice site probably null
IGL02429:Rph3a APN 5 120980124 splice site probably null
IGL02825:Rph3a APN 5 120945446 missense possibly damaging 0.94
R0282:Rph3a UTSW 5 120963910 nonsense probably null
R0325:Rph3a UTSW 5 120943064 missense probably benign 0.22
R0402:Rph3a UTSW 5 120942254 missense probably damaging 0.99
R0648:Rph3a UTSW 5 120959270 missense possibly damaging 0.77
R1807:Rph3a UTSW 5 120945393 missense probably damaging 0.99
R2273:Rph3a UTSW 5 120973304 missense probably damaging 0.98
R2519:Rph3a UTSW 5 120954422 missense probably damaging 1.00
R2865:Rph3a UTSW 5 120947927 missense probably damaging 1.00
R2939:Rph3a UTSW 5 120980149 splice site probably benign
R3153:Rph3a UTSW 5 120973377 missense probably damaging 1.00
R4289:Rph3a UTSW 5 120973305 missense probably damaging 1.00
R4775:Rph3a UTSW 5 120954488 missense probably benign 0.00
R4949:Rph3a UTSW 5 120963834 missense probably damaging 1.00
R4997:Rph3a UTSW 5 120963843 missense probably damaging 0.96
R5008:Rph3a UTSW 5 120945391 missense probably damaging 1.00
R5027:Rph3a UTSW 5 120954449 missense possibly damaging 0.90
R5155:Rph3a UTSW 5 120948770 missense possibly damaging 0.94
R5497:Rph3a UTSW 5 120942190 missense probably benign 0.28
R5931:Rph3a UTSW 5 120963873 missense probably damaging 0.99
R6273:Rph3a UTSW 5 120945422 missense possibly damaging 0.91
R7630:Rph3a UTSW 5 120943050 missense probably damaging 1.00
R7664:Rph3a UTSW 5 120961276 missense probably benign
R8210:Rph3a UTSW 5 120961249 missense probably benign 0.00
R8294:Rph3a UTSW 5 120961366 missense probably damaging 1.00
R8445:Rph3a UTSW 5 120973370 missense probably damaging 1.00
R8693:Rph3a UTSW 5 120962438 missense probably damaging 0.99
RF017:Rph3a UTSW 5 120962499 splice site probably null
Z1177:Rph3a UTSW 5 120942266 nonsense probably null
Z1177:Rph3a UTSW 5 120961275 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATTCCGGGAGTCAAGCAAAAC -3'
(R):5'- GGGTTCTGTCAACTGTCTCC -3'

Sequencing Primer
(F):5'- GAAGAGTTAGGATCTCAGTTACGTC -3'
(R):5'- GTCAACTGTCTCCCATTCTGG -3'
Posted On2021-04-30