Incidental Mutation 'R8758:Psg21'
ID 671738
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific glycoprotein 21
Synonyms 1600026N13Rik, 1600019C01Rik, 1600025N01Rik, cea8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock # R8758 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18646736-18656725 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18650753 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 356 (Y356C)
Ref Sequence ENSEMBL: ENSMUSP00000092387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably damaging
Transcript: ENSMUST00000094793
AA Change: Y356C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796
AA Change: Y356C

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182128
AA Change: Y356C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796
AA Change: Y356C

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik G A 4: 39,450,811 D6N probably benign Het
AC157566.4 T C 15: 76,534,182 I42M probably benign Het
Amer2 C T 14: 60,378,877 R174C probably damaging Het
Arl8a A T 1: 135,154,451 D139V possibly damaging Het
Csmd3 A G 15: 47,606,197 Y2525H Het
Cwc22 T C 2: 77,917,097 E424G possibly damaging Het
D930048N14Rik A G 11: 51,653,741 T80A unknown Het
Ddx25 T A 9: 35,542,004 E483D probably benign Het
Dock4 A T 12: 40,788,232 E1057D probably benign Het
Dock7 C T 4: 99,061,318 R429Q Het
Dzip3 T C 16: 48,977,937 Y135C probably damaging Het
Evi5l G T 8: 4,205,860 A618S probably benign Het
Fibp A G 19: 5,464,942 D348G possibly damaging Het
Gimd1 T A 3: 132,635,038 L105H probably damaging Het
Glra1 T A 11: 55,527,365 I268F possibly damaging Het
Gm30191 A G 4: 134,249,788 T104A probably benign Het
Gm49359 A T 13: 62,454,336 I350K possibly damaging Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
Igkv4-74 AG A 6: 69,185,327 probably null Het
Ikzf1 A G 11: 11,761,359 S198G probably benign Het
Kcna4 T A 2: 107,296,149 D409E probably damaging Het
Lipt2 GGCGCCCGCGCGCG GGCG 7: 100,159,681 probably null Het
Mgam T A 6: 40,729,043 D15E probably benign Het
Mmrn1 A G 6: 60,987,209 D1065G possibly damaging Het
Plxnc1 A C 10: 94,922,745 V363G possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Ranbp1 T C 16: 18,241,795 D130G probably damaging Het
Rb1cc1 A T 1: 6,240,227 Q283L probably benign Het
Rph3a A T 5: 120,959,302 H250Q probably benign Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Skil C T 3: 31,118,537 A605V probably damaging Het
Slc28a3 T C 13: 58,572,610 T312A probably benign Het
Ssh2 T A 11: 77,454,017 C943S probably benign Het
Tgfbi C T 13: 56,632,081 A481V probably damaging Het
Tgfbr3 G A 5: 107,149,884 P217S probably damaging Het
Tmem135 A T 7: 89,305,513 W99R probably benign Het
Tmx1 A G 12: 70,456,014 Y52C possibly damaging Het
Ube3b A T 5: 114,415,200 probably benign Het
Vmn2r57 G T 7: 41,428,739 N98K probably damaging Het
Vwa3b A G 1: 37,137,792 D40G Het
Zfyve26 A G 12: 79,264,309 probably benign Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18654825 missense probably damaging 1.00
IGL02390:Psg21 APN 7 18652631 missense probably benign 0.11
IGL02548:Psg21 APN 7 18655036 missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18652485 missense probably benign 0.03
IGL03135:Psg21 APN 7 18654918 missense probably benign 0.00
R0131:Psg21 UTSW 7 18654868 missense probably benign 0.39
R0551:Psg21 UTSW 7 18652640 critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18656500 missense probably benign 0.00
R1874:Psg21 UTSW 7 18650816 missense probably benign 0.15
R1993:Psg21 UTSW 7 18654770 missense probably benign 0.04
R2327:Psg21 UTSW 7 18652453 missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18652380 missense probably damaging 1.00
R4422:Psg21 UTSW 7 18647332 missense probably damaging 1.00
R5138:Psg21 UTSW 7 18656528 start codon destroyed probably null 0.94
R5623:Psg21 UTSW 7 18655014 missense probably damaging 1.00
R5686:Psg21 UTSW 7 18652258 intron probably benign
R6166:Psg21 UTSW 7 18656739 unclassified probably benign
R6177:Psg21 UTSW 7 18652354 missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18655001 missense possibly damaging 0.61
R6210:Psg21 UTSW 7 18652345 missense probably damaging 1.00
R6482:Psg21 UTSW 7 18654739 splice site probably null
R6729:Psg21 UTSW 7 18652591 missense probably damaging 1.00
R6866:Psg21 UTSW 7 18652284 missense probably damaging 1.00
R6992:Psg21 UTSW 7 18654743 critical splice donor site probably null
R7075:Psg21 UTSW 7 18654861 missense probably damaging 1.00
R7081:Psg21 UTSW 7 18654849 nonsense probably null
R7098:Psg21 UTSW 7 18652545 missense probably damaging 1.00
R7582:Psg21 UTSW 7 18647203 makesense probably null
R7588:Psg21 UTSW 7 18647209 missense probably benign 0.00
R7607:Psg21 UTSW 7 18654783 missense probably benign 0.02
R7830:Psg21 UTSW 7 18647298 missense probably damaging 1.00
R7964:Psg21 UTSW 7 18647211 missense probably benign 0.01
R8972:Psg21 UTSW 7 18647368 missense probably benign 0.03
R8988:Psg21 UTSW 7 18652464 missense probably benign 0.00
R9119:Psg21 UTSW 7 18647484 missense probably benign 0.14
R9446:Psg21 UTSW 7 18654940 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTGTTGGACCATCCCATG -3'
(R):5'- CAGAAGATCTGCAAACCTTTTCC -3'

Sequencing Primer
(F):5'- CATGTGTGCCCTGCAGTAAG -3'
(R):5'- GCAAACCTTTTCCTGGTACAAGGG -3'
Posted On 2021-04-30