Incidental Mutation 'R8758:Psg21'
ID 671738
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific beta-1-glycoprotein 21
Synonyms 1600019C01Rik, 1600026N13Rik, 1600025N01Rik, cea8
MMRRC Submission 068598-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R8758 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18380661-18390650 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18384678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 356 (Y356C)
Ref Sequence ENSEMBL: ENSMUSP00000092387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably damaging
Transcript: ENSMUST00000094793
AA Change: Y356C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796
AA Change: Y356C

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182128
AA Change: Y356C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796
AA Change: Y356C

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik G A 4: 39,450,811 (GRCm39) D6N probably benign Het
AC157566.4 T C 15: 76,418,382 (GRCm39) I42M probably benign Het
Amer2 C T 14: 60,616,326 (GRCm39) R174C probably damaging Het
Arl8a A T 1: 135,082,189 (GRCm39) D139V possibly damaging Het
Csmd3 A G 15: 47,469,593 (GRCm39) Y2525H Het
Cwc22 T C 2: 77,747,441 (GRCm39) E424G possibly damaging Het
D930048N14Rik A G 11: 51,544,568 (GRCm39) T80A unknown Het
Ddx25 T A 9: 35,453,300 (GRCm39) E483D probably benign Het
Dock4 A T 12: 40,838,231 (GRCm39) E1057D probably benign Het
Dock7 C T 4: 98,949,555 (GRCm39) R429Q Het
Dzip3 T C 16: 48,798,300 (GRCm39) Y135C probably damaging Het
Evi5l G T 8: 4,255,860 (GRCm39) A618S probably benign Het
Fibp A G 19: 5,514,970 (GRCm39) D348G possibly damaging Het
Gimd1 T A 3: 132,340,799 (GRCm39) L105H probably damaging Het
Glra1 T A 11: 55,418,191 (GRCm39) I268F possibly damaging Het
Gm30191 A G 4: 133,977,099 (GRCm39) T104A probably benign Het
Gm49359 A T 13: 62,602,150 (GRCm39) I350K possibly damaging Het
Gpm6a T C 8: 55,511,833 (GRCm39) S236P probably damaging Het
Igkv4-74 AG A 6: 69,162,311 (GRCm39) probably null Het
Ikzf1 A G 11: 11,711,359 (GRCm39) S198G probably benign Het
Kcna4 T A 2: 107,126,494 (GRCm39) D409E probably damaging Het
Lipt2 GGCGCCCGCGCGCG GGCG 7: 99,808,888 (GRCm39) probably null Het
Mgam T A 6: 40,705,977 (GRCm39) D15E probably benign Het
Mmrn1 A G 6: 60,964,193 (GRCm39) D1065G possibly damaging Het
Plxnc1 A C 10: 94,758,607 (GRCm39) V363G possibly damaging Het
Ppp1r16b G A 2: 158,593,098 (GRCm39) D226N probably damaging Het
Ranbp1 T C 16: 18,059,659 (GRCm39) D130G probably damaging Het
Rb1cc1 A T 1: 6,310,451 (GRCm39) Q283L probably benign Het
Rph3a A T 5: 121,097,365 (GRCm39) H250Q probably benign Het
Secisbp2 G A 13: 51,833,869 (GRCm39) V670I possibly damaging Het
Skil C T 3: 31,172,686 (GRCm39) A605V probably damaging Het
Slc28a3 T C 13: 58,720,424 (GRCm39) T312A probably benign Het
Ssh2 T A 11: 77,344,843 (GRCm39) C943S probably benign Het
Tgfbi C T 13: 56,779,894 (GRCm39) A481V probably damaging Het
Tgfbr3 G A 5: 107,297,750 (GRCm39) P217S probably damaging Het
Tmem135 A T 7: 88,954,721 (GRCm39) W99R probably benign Het
Tmx1 A G 12: 70,502,788 (GRCm39) Y52C possibly damaging Het
Ube3b A T 5: 114,553,261 (GRCm39) probably benign Het
Vmn2r57 G T 7: 41,078,163 (GRCm39) N98K probably damaging Het
Vwa3b A G 1: 37,176,873 (GRCm39) D40G Het
Zfyve26 A G 12: 79,311,083 (GRCm39) probably benign Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18,388,750 (GRCm39) missense probably damaging 1.00
IGL02390:Psg21 APN 7 18,386,556 (GRCm39) missense probably benign 0.11
IGL02548:Psg21 APN 7 18,388,961 (GRCm39) missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18,386,410 (GRCm39) missense probably benign 0.03
IGL03135:Psg21 APN 7 18,388,843 (GRCm39) missense probably benign 0.00
R0131:Psg21 UTSW 7 18,388,793 (GRCm39) missense probably benign 0.39
R0551:Psg21 UTSW 7 18,386,565 (GRCm39) critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18,390,425 (GRCm39) missense probably benign 0.00
R1874:Psg21 UTSW 7 18,384,741 (GRCm39) missense probably benign 0.15
R1993:Psg21 UTSW 7 18,388,695 (GRCm39) missense probably benign 0.04
R2327:Psg21 UTSW 7 18,386,378 (GRCm39) missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18,386,305 (GRCm39) missense probably damaging 1.00
R4422:Psg21 UTSW 7 18,381,257 (GRCm39) missense probably damaging 1.00
R5138:Psg21 UTSW 7 18,390,453 (GRCm39) start codon destroyed probably null 0.94
R5623:Psg21 UTSW 7 18,388,939 (GRCm39) missense probably damaging 1.00
R5686:Psg21 UTSW 7 18,386,183 (GRCm39) intron probably benign
R6166:Psg21 UTSW 7 18,390,664 (GRCm39) unclassified probably benign
R6177:Psg21 UTSW 7 18,386,279 (GRCm39) missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18,388,926 (GRCm39) missense possibly damaging 0.61
R6210:Psg21 UTSW 7 18,386,270 (GRCm39) missense probably damaging 1.00
R6482:Psg21 UTSW 7 18,388,664 (GRCm39) splice site probably null
R6729:Psg21 UTSW 7 18,386,516 (GRCm39) missense probably damaging 1.00
R6866:Psg21 UTSW 7 18,386,209 (GRCm39) missense probably damaging 1.00
R6992:Psg21 UTSW 7 18,388,668 (GRCm39) critical splice donor site probably null
R7075:Psg21 UTSW 7 18,388,786 (GRCm39) missense probably damaging 1.00
R7081:Psg21 UTSW 7 18,388,774 (GRCm39) nonsense probably null
R7098:Psg21 UTSW 7 18,386,470 (GRCm39) missense probably damaging 1.00
R7582:Psg21 UTSW 7 18,381,128 (GRCm39) makesense probably null
R7588:Psg21 UTSW 7 18,381,134 (GRCm39) missense probably benign 0.00
R7607:Psg21 UTSW 7 18,388,708 (GRCm39) missense probably benign 0.02
R7830:Psg21 UTSW 7 18,381,223 (GRCm39) missense probably damaging 1.00
R7964:Psg21 UTSW 7 18,381,136 (GRCm39) missense probably benign 0.01
R8972:Psg21 UTSW 7 18,381,293 (GRCm39) missense probably benign 0.03
R8988:Psg21 UTSW 7 18,386,389 (GRCm39) missense probably benign 0.00
R9119:Psg21 UTSW 7 18,381,409 (GRCm39) missense probably benign 0.14
R9446:Psg21 UTSW 7 18,388,865 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTGTTGGACCATCCCATG -3'
(R):5'- CAGAAGATCTGCAAACCTTTTCC -3'

Sequencing Primer
(F):5'- CATGTGTGCCCTGCAGTAAG -3'
(R):5'- GCAAACCTTTTCCTGGTACAAGGG -3'
Posted On 2021-04-30