Incidental Mutation 'R8758:Fibp'
ID671762
Institutional Source Beutler Lab
Gene Symbol Fibp
Ensembl Gene ENSMUSG00000024911
Gene Namefibroblast growth factor (acidic) intracellular binding protein
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R8758 (G1)
Quality Score201.009
Status Not validated
Chromosome19
Chromosomal Location5460616-5465051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5464942 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 348 (D348G)
Ref Sequence ENSEMBL: ENSMUSP00000025847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025844] [ENSMUST00000025847] [ENSMUST00000225141]
Predicted Effect probably benign
Transcript: ENSMUST00000025844
SMART Domains Protein: ENSMUSP00000025844
Gene: ENSMUSG00000024910

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Inhibitor_I29 40 97 2.21e-12 SMART
Pept_C1 126 357 1.58e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000025847
AA Change: D348G

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025847
Gene: ENSMUSG00000024911
AA Change: D348G

DomainStartEndE-ValueType
Pfam:FIBP 3 363 7.6e-171 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000225141
AA Change: D341G

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acidic fibroblast growth factor is mitogenic for a variety of different cell types and acts by stimulating mitogenesis or inducing morphological changes and differentiation. The FIBP protein is an intracellular protein that binds selectively to acidic fibroblast growth factor (aFGF). It is postulated that FIBP may be involved in the mitogenic action of aFGF. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik G A 4: 39,450,811 D6N probably benign Het
AC157566.4 T C 15: 76,534,182 I42M probably benign Het
Amer2 C T 14: 60,378,877 R174C probably damaging Het
Arl8a A T 1: 135,154,451 D139V possibly damaging Het
Csmd3 A G 15: 47,606,197 Y2525H Het
Cwc22 T C 2: 77,917,097 E424G possibly damaging Het
D930048N14Rik A G 11: 51,653,741 T80A unknown Het
Ddx25 T A 9: 35,542,004 E483D probably benign Het
Dock4 A T 12: 40,788,232 E1057D probably benign Het
Dock7 C T 4: 99,061,318 R429Q Het
Dzip3 T C 16: 48,977,937 Y135C probably damaging Het
Evi5l G T 8: 4,205,860 A618S probably benign Het
Gimd1 T A 3: 132,635,038 L105H probably damaging Het
Glra1 T A 11: 55,527,365 I268F possibly damaging Het
Gm30191 A G 4: 134,249,788 T104A probably benign Het
Gm49359 A T 13: 62,454,336 I350K possibly damaging Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
Igkv4-74 AG A 6: 69,185,327 probably null Het
Ikzf1 A G 11: 11,761,359 S198G probably benign Het
Kcna4 T A 2: 107,296,149 D409E probably damaging Het
Lipt2 GGCGCCCGCGCGCG GGCG 7: 100,159,681 probably null Het
Mgam T A 6: 40,729,043 D15E probably benign Het
Mmrn1 A G 6: 60,987,209 D1065G possibly damaging Het
Plxnc1 A C 10: 94,922,745 V363G possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Psg21 T C 7: 18,650,753 Y356C probably damaging Het
Ranbp1 T C 16: 18,241,795 D130G probably damaging Het
Rb1cc1 A T 1: 6,240,227 Q283L probably benign Het
Rph3a A T 5: 120,959,302 H250Q probably benign Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Skil C T 3: 31,118,537 A605V probably damaging Het
Slc28a3 T C 13: 58,572,610 T312A probably benign Het
Ssh2 T A 11: 77,454,017 C943S probably benign Het
Tgfbi C T 13: 56,632,081 A481V probably damaging Het
Tgfbr3 G A 5: 107,149,884 P217S probably damaging Het
Tmem135 A T 7: 89,305,513 W99R probably benign Het
Tmx1 A G 12: 70,456,014 Y52C possibly damaging Het
Ube3b A T 5: 114,415,200 probably benign Het
Vmn2r57 G T 7: 41,428,739 N98K probably damaging Het
Vwa3b A G 1: 37,137,792 D40G Het
Zfyve26 A G 12: 79,264,309 probably benign Het
Other mutations in Fibp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02246:Fibp APN 19 5463236 missense probably damaging 1.00
R0539:Fibp UTSW 19 5463188 missense probably damaging 1.00
R1350:Fibp UTSW 19 5461391 missense probably damaging 1.00
R1708:Fibp UTSW 19 5463794 missense probably null 1.00
R4021:Fibp UTSW 19 5460734 splice site probably null
R5556:Fibp UTSW 19 5464199 missense possibly damaging 0.74
R5915:Fibp UTSW 19 5463616 missense possibly damaging 0.92
R5932:Fibp UTSW 19 5464425 missense probably benign 0.01
R7083:Fibp UTSW 19 5463631 missense probably damaging 1.00
R7131:Fibp UTSW 19 5461491 missense probably damaging 0.97
R7762:Fibp UTSW 19 5464174 missense probably benign 0.12
R8465:Fibp UTSW 19 5463187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCTTCTCTGTTGAACTGCC -3'
(R):5'- ACAGCACTTGAGCACACATG -3'

Sequencing Primer
(F):5'- GTTTGTATTCCCAGCACATCGGAAG -3'
(R):5'- CACATGTGTGCACTGTGGGAATC -3'
Posted On2021-04-30