Mutagenetix > Incidental Mutation

Incidental Mutation 'R8759:Itga8'

671768

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

068718-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.913) question?

Stock #

R8759 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12262129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 165 (D165G)

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably damaging
Transcript: ENSMUST00000028106
AA Change: D165G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: D165G

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172791
AA Change: D165G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: D165G

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	T	C	8: 124,639,177	T276A	probably benign	Het
6030468B19Rik	T	C	11: 117,806,286	V237A	probably benign	Het
9530003J23Rik	T	A	10: 117,234,435	I146F	probably damaging	Het
Abca15	G	A	7: 120,407,408	V1632M	probably damaging	Het
Adamts18	G	A	8: 113,706,992	P1037S	probably damaging	Het
Apol7e	T	C	15: 77,717,865	V221A	probably benign	Het
Aqp4	T	G	18: 15,399,991	H15P	probably benign	Het
Atp6v0d2	T	A	4: 19,910,649	R80S	probably benign	Het
Cdh15	A	G	8: 122,860,889	D184G	probably damaging	Het
Cers3	G	A	7: 66,786,102	V270M	probably damaging	Het
Ces3a	A	G	8: 105,057,497	H443R	probably damaging	Het
Cntn1	T	G	15: 92,255,920	F485V	possibly damaging	Het
Cog6	A	G	3: 52,990,044	L536P	probably damaging	Het
Copa	A	G	1: 172,119,514	I1068M	probably benign	Het
Ddx50	T	C	10: 62,616,242	D734G	unknown	Het
Dgkz	T	C	2: 91,945,577	T114A	probably benign	Het
Dock2	A	T	11: 34,695,240	D538E	probably benign	Het
Drg1	T	C	11: 3,254,633	S198G	probably benign	Het
Epn3	C	A	11: 94,496,022	G174V	possibly damaging	Het
Ficd	G	T	5: 113,738,514	R250L	probably damaging	Het
Fmo2	A	G	1: 162,880,436	S377P	probably benign	Het
Gm17027	T	C	14: 42,159,294	I202V		Het
Gm7879	A	T	5: 43,913,657	N119I	probably benign	Het
H6pd	C	T	4: 149,982,301	V551I	probably benign	Het
Ighg1	A	T	12: 113,329,037	L304*	probably null	Het
Lipt2	GGCGCCCGCGCGCG	GGCG	7: 100,159,681		probably null	Het
Lrrc37a	A	G	11: 103,457,940	V2643A	unknown	Het
Mast2	A	T	4: 116,435,560	F71Y	possibly damaging	Het
Mkrn1	C	A	6: 39,399,410	E421*	probably null	Het
Myo3a	G	T	2: 22,558,307	K969N	possibly damaging	Het
Nr1d1	G	C	11: 98,769,247	R484G	probably damaging	Het
Nrg1	C	A	8: 31,818,075	A686S	probably damaging	Het
Olfr671	T	C	7: 104,975,118	N293S	probably damaging	Het
Plxna4	T	A	6: 32,192,341	D1307V	probably damaging	Het
Ppp1r13l	G	T	7: 19,370,056	G154V	probably damaging	Het
Psmc5	A	G	11: 106,262,861	D382G	probably benign	Het
Ptch2	T	C	4: 117,110,433	L766P	probably damaging	Het
Rev1	A	C	1: 38,059,272	L730R	probably damaging	Het
Rin3	G	A	12: 102,373,602	V684I	probably damaging	Het
Secisbp2	G	A	13: 51,679,833	V670I	possibly damaging	Het
Sema6d	G	A	2: 124,655,214	C136Y	probably damaging	Het
Shprh	T	G	10: 11,157,164	V298G	possibly damaging	Het
Slc37a4	C	T	9: 44,402,335	T386I	probably benign	Het
Slc4a3	T	C	1: 75,554,638	I825T	probably damaging	Het
Spta1	C	T	1: 174,213,374	L1247F	probably damaging	Het
Tigar	A	T	6: 127,091,257	I66K	probably benign	Het
Tln2	T	C	9: 67,367,218	Y376C	probably damaging	Het
Tmem199	T	A	11: 78,507,807		probably benign	Het
Tnc	G	A	4: 64,006,264	R1066C	possibly damaging	Het
Ubqlnl	T	A	7: 104,149,999	H97L	probably damaging	Het
Vmn1r13	A	G	6: 57,210,539	T228A	probably damaging	Het
Xab2	T	C	8: 3,611,672	T594A	probably benign	Het
Zc3h18	A	G	8: 122,411,385	E687G	unknown	Het
Zfp831	A	G	2: 174,646,081	T850A	probably benign	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- ATCTTCTGTCACAGCTCTCAAG -3'
(R):5'- CATGCTGAAGGTGGATTAGTTCATG -3'

Sequencing Primer
(F):5'- TTCCATTTCAAATGCTATCCCCAAAG -3'
(R):5'- CTTGTCAACAATTCAGACAATATTGG -3'

Posted On

2021-04-30