Incidental Mutation 'R8759:Myo3a'
ID 671769
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Name myosin IIIA
Synonyms 9030416P08Rik
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 22227503-22618252 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 22558307 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 969 (K969N)
Ref Sequence ENSEMBL: ENSMUSP00000046329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000138863]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000044749
AA Change: K969N

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: K969N

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138863
AA Change: K31N

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116185
Gene: ENSMUSG00000025716
AA Change: K31N

DomainStartEndE-ValueType
Pfam:Myosin_head 1 110 1.7e-28 PFAM
IQ 123 145 2.88e1 SMART
IQ 150 172 9.48e-3 SMART
low complexity region 215 231 N/A INTRINSIC
low complexity region 421 431 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,639,177 T276A probably benign Het
6030468B19Rik T C 11: 117,806,286 V237A probably benign Het
9530003J23Rik T A 10: 117,234,435 I146F probably damaging Het
Abca15 G A 7: 120,407,408 V1632M probably damaging Het
Adamts18 G A 8: 113,706,992 P1037S probably damaging Het
Apol7e T C 15: 77,717,865 V221A probably benign Het
Aqp4 T G 18: 15,399,991 H15P probably benign Het
Atp6v0d2 T A 4: 19,910,649 R80S probably benign Het
Cdh15 A G 8: 122,860,889 D184G probably damaging Het
Cers3 G A 7: 66,786,102 V270M probably damaging Het
Ces3a A G 8: 105,057,497 H443R probably damaging Het
Cntn1 T G 15: 92,255,920 F485V possibly damaging Het
Cog6 A G 3: 52,990,044 L536P probably damaging Het
Copa A G 1: 172,119,514 I1068M probably benign Het
Ddx50 T C 10: 62,616,242 D734G unknown Het
Dgkz T C 2: 91,945,577 T114A probably benign Het
Dock2 A T 11: 34,695,240 D538E probably benign Het
Drg1 T C 11: 3,254,633 S198G probably benign Het
Epn3 C A 11: 94,496,022 G174V possibly damaging Het
Ficd G T 5: 113,738,514 R250L probably damaging Het
Fmo2 A G 1: 162,880,436 S377P probably benign Het
Gm17027 T C 14: 42,159,294 I202V Het
Gm7879 A T 5: 43,913,657 N119I probably benign Het
H6pd C T 4: 149,982,301 V551I probably benign Het
Ighg1 A T 12: 113,329,037 L304* probably null Het
Itga8 T C 2: 12,262,129 D165G probably damaging Het
Lipt2 GGCGCCCGCGCGCG GGCG 7: 100,159,681 probably null Het
Lrrc37a A G 11: 103,457,940 V2643A unknown Het
Mast2 A T 4: 116,435,560 F71Y possibly damaging Het
Mkrn1 C A 6: 39,399,410 E421* probably null Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Nrg1 C A 8: 31,818,075 A686S probably damaging Het
Olfr671 T C 7: 104,975,118 N293S probably damaging Het
Plxna4 T A 6: 32,192,341 D1307V probably damaging Het
Ppp1r13l G T 7: 19,370,056 G154V probably damaging Het
Psmc5 A G 11: 106,262,861 D382G probably benign Het
Ptch2 T C 4: 117,110,433 L766P probably damaging Het
Rev1 A C 1: 38,059,272 L730R probably damaging Het
Rin3 G A 12: 102,373,602 V684I probably damaging Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Sema6d G A 2: 124,655,214 C136Y probably damaging Het
Shprh T G 10: 11,157,164 V298G possibly damaging Het
Slc37a4 C T 9: 44,402,335 T386I probably benign Het
Slc4a3 T C 1: 75,554,638 I825T probably damaging Het
Spta1 C T 1: 174,213,374 L1247F probably damaging Het
Tigar A T 6: 127,091,257 I66K probably benign Het
Tln2 T C 9: 67,367,218 Y376C probably damaging Het
Tmem199 T A 11: 78,507,807 probably benign Het
Tnc G A 4: 64,006,264 R1066C possibly damaging Het
Ubqlnl T A 7: 104,149,999 H97L probably damaging Het
Vmn1r13 A G 6: 57,210,539 T228A probably damaging Het
Xab2 T C 8: 3,611,672 T594A probably benign Het
Zc3h18 A G 8: 122,411,385 E687G unknown Het
Zfp831 A G 2: 174,646,081 T850A probably benign Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
lose UTSW 2 22558320 nonsense probably null
snooze UTSW 2 22282634 missense probably damaging 0.99
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense possibly damaging 0.78
R7301:Myo3a UTSW 2 22544466 critical splice donor site probably null
R7318:Myo3a UTSW 2 22558320 nonsense probably null
R7447:Myo3a UTSW 2 22544426 missense probably benign 0.27
R7456:Myo3a UTSW 2 22407444 missense probably benign 0.08
R7528:Myo3a UTSW 2 22266114 nonsense probably null
R7731:Myo3a UTSW 2 22282589 missense probably damaging 1.00
R7768:Myo3a UTSW 2 22241143 missense probably damaging 0.99
R8054:Myo3a UTSW 2 22574317 missense probably benign 0.00
R8140:Myo3a UTSW 2 22407346 missense probably damaging 1.00
R8143:Myo3a UTSW 2 22282665 critical splice donor site probably null
R8346:Myo3a UTSW 2 22558422 critical splice donor site probably null
R8421:Myo3a UTSW 2 22362124 missense probably benign 0.07
R8495:Myo3a UTSW 2 22396273 missense probably damaging 0.96
R8551:Myo3a UTSW 2 22332466 missense probably benign 0.00
R8708:Myo3a UTSW 2 22291796 splice site probably benign
R8757:Myo3a UTSW 2 22558307 missense possibly damaging 0.49
R8779:Myo3a UTSW 2 22245593 nonsense probably null
R8828:Myo3a UTSW 2 22241053 missense probably benign 0.01
R8910:Myo3a UTSW 2 22574268 missense probably benign 0.01
R8916:Myo3a UTSW 2 22567692 missense probably damaging 1.00
R8926:Myo3a UTSW 2 22396263 missense possibly damaging 0.95
R9028:Myo3a UTSW 2 22600087 missense possibly damaging 0.79
R9046:Myo3a UTSW 2 22558355 missense probably damaging 0.99
R9120:Myo3a UTSW 2 22544426 missense probably benign 0.27
R9153:Myo3a UTSW 2 22399933 missense probably benign 0.02
R9191:Myo3a UTSW 2 22579829 missense probably benign 0.24
R9258:Myo3a UTSW 2 22577533 missense possibly damaging 0.60
R9436:Myo3a UTSW 2 22407424 nonsense probably null
Z1177:Myo3a UTSW 2 22618140 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- ACTGTGACTAACCACTTGTAACG -3'
(R):5'- TGCCTAGACTACTTGCTGTTTTATG -3'

Sequencing Primer
(F):5'- ACCTTGTAATAAAAATGAAGACC -3'
(R):5'- AGACTACTTGCTGTTTTATGTTCTAC -3'
Posted On 2021-04-30