Incidental Mutation 'R8759:Atp6v0d2'
ID 671774
Institutional Source Beutler Lab
Gene Symbol Atp6v0d2
Ensembl Gene ENSMUSG00000028238
Gene Name ATPase, H+ transporting, lysosomal V0 subunit D2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 19876841-19922605 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19910649 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 80 (R80S)
Ref Sequence ENSEMBL: ENSMUSP00000029900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029900] [ENSMUST00000128605]
AlphaFold Q80SY3
Predicted Effect probably benign
Transcript: ENSMUST00000029900
AA Change: R80S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029900
Gene: ENSMUSG00000028238
AA Change: R80S

DomainStartEndE-ValueType
Pfam:vATP-synt_AC39 16 346 6.2e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128605
AA Change: R7S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display osteopetrosis and impaired osteoclast maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,639,177 T276A probably benign Het
6030468B19Rik T C 11: 117,806,286 V237A probably benign Het
9530003J23Rik T A 10: 117,234,435 I146F probably damaging Het
Abca15 G A 7: 120,407,408 V1632M probably damaging Het
Adamts18 G A 8: 113,706,992 P1037S probably damaging Het
Apol7e T C 15: 77,717,865 V221A probably benign Het
Aqp4 T G 18: 15,399,991 H15P probably benign Het
Cdh15 A G 8: 122,860,889 D184G probably damaging Het
Cers3 G A 7: 66,786,102 V270M probably damaging Het
Ces3a A G 8: 105,057,497 H443R probably damaging Het
Cntn1 T G 15: 92,255,920 F485V possibly damaging Het
Cog6 A G 3: 52,990,044 L536P probably damaging Het
Copa A G 1: 172,119,514 I1068M probably benign Het
Ddx50 T C 10: 62,616,242 D734G unknown Het
Dgkz T C 2: 91,945,577 T114A probably benign Het
Dock2 A T 11: 34,695,240 D538E probably benign Het
Drg1 T C 11: 3,254,633 S198G probably benign Het
Epn3 C A 11: 94,496,022 G174V possibly damaging Het
Ficd G T 5: 113,738,514 R250L probably damaging Het
Fmo2 A G 1: 162,880,436 S377P probably benign Het
Gm17027 T C 14: 42,159,294 I202V Het
Gm7879 A T 5: 43,913,657 N119I probably benign Het
H6pd C T 4: 149,982,301 V551I probably benign Het
Ighg1 A T 12: 113,329,037 L304* probably null Het
Itga8 T C 2: 12,262,129 D165G probably damaging Het
Lipt2 GGCGCCCGCGCGCG GGCG 7: 100,159,681 probably null Het
Lrrc37a A G 11: 103,457,940 V2643A unknown Het
Mast2 A T 4: 116,435,560 F71Y possibly damaging Het
Mkrn1 C A 6: 39,399,410 E421* probably null Het
Myo3a G T 2: 22,558,307 K969N possibly damaging Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Nrg1 C A 8: 31,818,075 A686S probably damaging Het
Olfr671 T C 7: 104,975,118 N293S probably damaging Het
Plxna4 T A 6: 32,192,341 D1307V probably damaging Het
Ppp1r13l G T 7: 19,370,056 G154V probably damaging Het
Psmc5 A G 11: 106,262,861 D382G probably benign Het
Ptch2 T C 4: 117,110,433 L766P probably damaging Het
Rev1 A C 1: 38,059,272 L730R probably damaging Het
Rin3 G A 12: 102,373,602 V684I probably damaging Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Sema6d G A 2: 124,655,214 C136Y probably damaging Het
Shprh T G 10: 11,157,164 V298G possibly damaging Het
Slc37a4 C T 9: 44,402,335 T386I probably benign Het
Slc4a3 T C 1: 75,554,638 I825T probably damaging Het
Spta1 C T 1: 174,213,374 L1247F probably damaging Het
Tigar A T 6: 127,091,257 I66K probably benign Het
Tln2 T C 9: 67,367,218 Y376C probably damaging Het
Tmem199 T A 11: 78,507,807 probably benign Het
Tnc G A 4: 64,006,264 R1066C possibly damaging Het
Ubqlnl T A 7: 104,149,999 H97L probably damaging Het
Vmn1r13 A G 6: 57,210,539 T228A probably damaging Het
Xab2 T C 8: 3,611,672 T594A probably benign Het
Zc3h18 A G 8: 122,411,385 E687G unknown Het
Zfp831 A G 2: 174,646,081 T850A probably benign Het
Other mutations in Atp6v0d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Atp6v0d2 APN 4 19881436 missense probably damaging 1.00
IGL01759:Atp6v0d2 APN 4 19878335 missense probably damaging 0.98
IGL02006:Atp6v0d2 APN 4 19878325 missense probably damaging 1.00
IGL02515:Atp6v0d2 APN 4 19880063 missense possibly damaging 0.63
IGL03100:Atp6v0d2 APN 4 19910586 critical splice donor site probably null
IGL02796:Atp6v0d2 UTSW 4 19887324 missense probably damaging 1.00
R0083:Atp6v0d2 UTSW 4 19880001 splice site probably benign
R0133:Atp6v0d2 UTSW 4 19910578 splice site probably benign
R0371:Atp6v0d2 UTSW 4 19880033 missense possibly damaging 0.92
R0845:Atp6v0d2 UTSW 4 19880055 missense probably benign 0.02
R1279:Atp6v0d2 UTSW 4 19878298 missense probably benign 0.02
R1541:Atp6v0d2 UTSW 4 19910645 missense probably damaging 1.00
R1802:Atp6v0d2 UTSW 4 19922366 critical splice donor site probably null
R3417:Atp6v0d2 UTSW 4 19888829 unclassified probably benign
R3833:Atp6v0d2 UTSW 4 19922395 missense probably damaging 1.00
R3884:Atp6v0d2 UTSW 4 19910677 missense probably damaging 1.00
R5158:Atp6v0d2 UTSW 4 19878292 missense probably damaging 1.00
R6284:Atp6v0d2 UTSW 4 19922605 splice site probably null
R7290:Atp6v0d2 UTSW 4 19880060 missense probably benign 0.44
R7341:Atp6v0d2 UTSW 4 19887330 missense possibly damaging 0.46
R7832:Atp6v0d2 UTSW 4 19922400 missense probably benign 0.18
R8231:Atp6v0d2 UTSW 4 19881451 missense probably damaging 1.00
R8757:Atp6v0d2 UTSW 4 19910649 missense probably benign
R8811:Atp6v0d2 UTSW 4 19922397 missense probably benign 0.05
R9227:Atp6v0d2 UTSW 4 19878374 missense probably benign
R9334:Atp6v0d2 UTSW 4 19890695 missense probably damaging 1.00
R9378:Atp6v0d2 UTSW 4 19922377 missense probably benign 0.02
R9716:Atp6v0d2 UTSW 4 19890834 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGGTTATTACCACCTCACATC -3'
(R):5'- GCCTCTACCATAATGTTACCACAAG -3'

Sequencing Primer
(F):5'- ACTAGGTTGTAAAATTACCAGTTGC -3'
(R):5'- AGCACATCTCCAAGTTTAACTTTGC -3'
Posted On 2021-04-30