Incidental Mutation 'R8759:Shprh'
ID671800
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene NameSNF2 histone linker PHD RING helicase
Synonyms2610103K11Rik, D230017O13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8759 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location11149427-11217595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 11157164 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 298 (V298G)
Ref Sequence ENSEMBL: ENSMUSP00000039422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044053
AA Change: V298G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: V298G

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000054814
AA Change: V298G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: V298G

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159541
AA Change: V298G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: V298G

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159810
AA Change: V298G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: V298G

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,639,177 T276A probably benign Het
6030468B19Rik T C 11: 117,806,286 V237A probably benign Het
9530003J23Rik T A 10: 117,234,435 I146F probably damaging Het
Abca15 G A 7: 120,407,408 V1632M probably damaging Het
Adamts18 G A 8: 113,706,992 P1037S probably damaging Het
Apol7e T C 15: 77,717,865 V221A probably benign Het
Aqp4 T G 18: 15,399,991 H15P probably benign Het
Atp6v0d2 T A 4: 19,910,649 R80S probably benign Het
Cdh15 A G 8: 122,860,889 D184G probably damaging Het
Cers3 G A 7: 66,786,102 V270M probably damaging Het
Ces3a A G 8: 105,057,497 H443R probably damaging Het
Cntn1 T G 15: 92,255,920 F485V possibly damaging Het
Cog6 A G 3: 52,990,044 L536P probably damaging Het
Copa A G 1: 172,119,514 I1068M probably benign Het
Ddx50 T C 10: 62,616,242 D734G unknown Het
Dgkz T C 2: 91,945,577 T114A probably benign Het
Dock2 A T 11: 34,695,240 D538E probably benign Het
Drg1 T C 11: 3,254,633 S198G probably benign Het
Epn3 C A 11: 94,496,022 G174V possibly damaging Het
Ficd G T 5: 113,738,514 R250L probably damaging Het
Fmo2 A G 1: 162,880,436 S377P probably benign Het
Gm17027 T C 14: 42,159,294 I202V Het
Gm7879 A T 5: 43,913,657 N119I probably benign Het
H6pd C T 4: 149,982,301 V551I probably benign Het
Ighg1 A T 12: 113,329,037 L304* probably null Het
Itga8 T C 2: 12,262,129 D165G probably damaging Het
Lipt2 GGCGCCCGCGCGCG GGCG 7: 100,159,681 probably null Het
Lrrc37a A G 11: 103,457,940 V2643A unknown Het
Mast2 A T 4: 116,435,560 F71Y possibly damaging Het
Mkrn1 C A 6: 39,399,410 E421* probably null Het
Myo3a G T 2: 22,558,307 K969N possibly damaging Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Nrg1 C A 8: 31,818,075 A686S probably damaging Het
Olfr671 T C 7: 104,975,118 N293S probably damaging Het
Plxna4 T A 6: 32,192,341 D1307V probably damaging Het
Ppp1r13l G T 7: 19,370,056 G154V probably damaging Het
Psmc5 A G 11: 106,262,861 D382G probably benign Het
Ptch2 T C 4: 117,110,433 L766P probably damaging Het
Rev1 A C 1: 38,059,272 L730R probably damaging Het
Rin3 G A 12: 102,373,602 V684I probably damaging Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Sema6d G A 2: 124,655,214 C136Y probably damaging Het
Slc37a4 C T 9: 44,402,335 T386I probably benign Het
Slc4a3 T C 1: 75,554,638 I825T probably damaging Het
Spta1 C T 1: 174,213,374 L1247F probably damaging Het
Tigar A T 6: 127,091,257 I66K probably benign Het
Tln2 T C 9: 67,367,218 Y376C probably damaging Het
Tmem199 T A 11: 78,507,807 probably benign Het
Tnc G A 4: 64,006,264 R1066C possibly damaging Het
Ubqlnl T A 7: 104,149,999 H97L probably damaging Het
Vmn1r13 A G 6: 57,210,539 T228A probably damaging Het
Xab2 T C 8: 3,611,672 T594A probably benign Het
Zc3h18 A G 8: 122,411,385 E687G unknown Het
Zfp831 A G 2: 174,646,081 T850A probably benign Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11192494 frame shift probably null
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0494:Shprh UTSW 10 11157191 missense probably damaging 1.00
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1588:Shprh UTSW 10 11164744 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4867:Shprh UTSW 10 11164557 missense probably benign 0.00
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5318:Shprh UTSW 10 11166557 missense probably benign 0.04
R5323:Shprh UTSW 10 11170297 splice site probably null
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R6971:Shprh UTSW 10 11166693 missense probably damaging 1.00
R7158:Shprh UTSW 10 11166730 missense probably damaging 0.98
R7582:Shprh UTSW 10 11164705 missense probably benign
R7757:Shprh UTSW 10 11162180 missense probably benign 0.30
R7812:Shprh UTSW 10 11151991 missense probably benign
R7998:Shprh UTSW 10 11185341 missense probably damaging 1.00
R8061:Shprh UTSW 10 11212333 missense possibly damaging 0.71
R8082:Shprh UTSW 10 11151811 missense probably benign 0.22
R8116:Shprh UTSW 10 11213461 missense probably damaging 0.99
R8390:Shprh UTSW 10 11187983 missense possibly damaging 0.92
R8445:Shprh UTSW 10 11181569 missense possibly damaging 0.92
R8530:Shprh UTSW 10 11151934 missense probably benign 0.37
R8937:Shprh UTSW 10 11185437 missense possibly damaging 0.60
RF012:Shprh UTSW 10 11164841 missense probably benign 0.02
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Z1176:Shprh UTSW 10 11164553 missense probably benign
Z1176:Shprh UTSW 10 11186447 missense probably damaging 1.00
Z1177:Shprh UTSW 10 11151762 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTAGGGGTGAGACCAATCCAG -3'
(R):5'- ATGATTACTTGCCGTCACCC -3'

Sequencing Primer
(F):5'- TGTGGCTTACAATGCAGACTC -3'
(R):5'- TTGCCGTCACCCCAATACATG -3'
Posted On2021-04-30