Incidental Mutation 'R8759:Aqp4'
ID671817
Institutional Source Beutler Lab
Gene Symbol Aqp4
Ensembl Gene ENSMUSG00000024411
Gene Nameaquaporin 4
Synonymsaquaporin-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R8759 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location15389394-15403684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 15399991 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 15 (H15P)
Ref Sequence ENSEMBL: ENSMUSP00000078088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079081]
Predicted Effect probably benign
Transcript: ENSMUST00000079081
AA Change: H15P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078088
Gene: ENSMUSG00000024411
AA Change: H15P

DomainStartEndE-ValueType
Pfam:MIP 29 248 8.7e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit decreased urine osmolality associated with reduced water permeability in inner medullary collecting ducts, increased survival rates and reduced brain edema after acute water intoxication and ischemic stroke, aswell as significant hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,639,177 T276A probably benign Het
6030468B19Rik T C 11: 117,806,286 V237A probably benign Het
9530003J23Rik T A 10: 117,234,435 I146F probably damaging Het
Abca15 G A 7: 120,407,408 V1632M probably damaging Het
Adamts18 G A 8: 113,706,992 P1037S probably damaging Het
Apol7e T C 15: 77,717,865 V221A probably benign Het
Atp6v0d2 T A 4: 19,910,649 R80S probably benign Het
Cdh15 A G 8: 122,860,889 D184G probably damaging Het
Cers3 G A 7: 66,786,102 V270M probably damaging Het
Ces3a A G 8: 105,057,497 H443R probably damaging Het
Cntn1 T G 15: 92,255,920 F485V possibly damaging Het
Cog6 A G 3: 52,990,044 L536P probably damaging Het
Copa A G 1: 172,119,514 I1068M probably benign Het
Ddx50 T C 10: 62,616,242 D734G unknown Het
Dgkz T C 2: 91,945,577 T114A probably benign Het
Dock2 A T 11: 34,695,240 D538E probably benign Het
Drg1 T C 11: 3,254,633 S198G probably benign Het
Epn3 C A 11: 94,496,022 G174V possibly damaging Het
Ficd G T 5: 113,738,514 R250L probably damaging Het
Fmo2 A G 1: 162,880,436 S377P probably benign Het
Gm17027 T C 14: 42,159,294 I202V Het
Gm7879 A T 5: 43,913,657 N119I probably benign Het
H6pd C T 4: 149,982,301 V551I probably benign Het
Ighg1 A T 12: 113,329,037 L304* probably null Het
Itga8 T C 2: 12,262,129 D165G probably damaging Het
Lipt2 GGCGCCCGCGCGCG GGCG 7: 100,159,681 probably null Het
Lrrc37a A G 11: 103,457,940 V2643A unknown Het
Mast2 A T 4: 116,435,560 F71Y possibly damaging Het
Mkrn1 C A 6: 39,399,410 E421* probably null Het
Myo3a G T 2: 22,558,307 K969N possibly damaging Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Nrg1 C A 8: 31,818,075 A686S probably damaging Het
Olfr671 T C 7: 104,975,118 N293S probably damaging Het
Plxna4 T A 6: 32,192,341 D1307V probably damaging Het
Ppp1r13l G T 7: 19,370,056 G154V probably damaging Het
Psmc5 A G 11: 106,262,861 D382G probably benign Het
Ptch2 T C 4: 117,110,433 L766P probably damaging Het
Rev1 A C 1: 38,059,272 L730R probably damaging Het
Rin3 G A 12: 102,373,602 V684I probably damaging Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Sema6d G A 2: 124,655,214 C136Y probably damaging Het
Shprh T G 10: 11,157,164 V298G possibly damaging Het
Slc37a4 C T 9: 44,402,335 T386I probably benign Het
Slc4a3 T C 1: 75,554,638 I825T probably damaging Het
Spta1 C T 1: 174,213,374 L1247F probably damaging Het
Tigar A T 6: 127,091,257 I66K probably benign Het
Tln2 T C 9: 67,367,218 Y376C probably damaging Het
Tmem199 T A 11: 78,507,807 probably benign Het
Tnc G A 4: 64,006,264 R1066C possibly damaging Het
Ubqlnl T A 7: 104,149,999 H97L probably damaging Het
Vmn1r13 A G 6: 57,210,539 T228A probably damaging Het
Xab2 T C 8: 3,611,672 T594A probably benign Het
Zc3h18 A G 8: 122,411,385 E687G unknown Het
Zfp831 A G 2: 174,646,081 T850A probably benign Het
Other mutations in Aqp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Aqp4 APN 18 15393599 missense probably benign 0.01
IGL01700:Aqp4 APN 18 15399865 missense probably benign 0.44
IGL02409:Aqp4 APN 18 15399725 missense probably benign 0.02
IGL02812:Aqp4 APN 18 15397575 splice site probably null
IGL03157:Aqp4 APN 18 15399980 missense probably benign 0.18
IGL03196:Aqp4 APN 18 15393509 missense probably benign 0.19
R0358:Aqp4 UTSW 18 15398245 missense probably benign
R1061:Aqp4 UTSW 18 15398191 missense probably damaging 1.00
R1981:Aqp4 UTSW 18 15393551 missense probably damaging 0.98
R1982:Aqp4 UTSW 18 15393551 missense probably damaging 0.98
R2274:Aqp4 UTSW 18 15393480 missense probably benign
R3033:Aqp4 UTSW 18 15393560 missense possibly damaging 0.80
R4608:Aqp4 UTSW 18 15398126 missense probably benign 0.25
R4817:Aqp4 UTSW 18 15399758 missense probably damaging 1.00
R4882:Aqp4 UTSW 18 15398254 missense possibly damaging 0.73
R5870:Aqp4 UTSW 18 15399889 missense probably damaging 1.00
R6235:Aqp4 UTSW 18 15398113 missense probably damaging 1.00
R6334:Aqp4 UTSW 18 15393591 missense probably benign
R6856:Aqp4 UTSW 18 15399896 missense possibly damaging 0.88
R7753:Aqp4 UTSW 18 15399976 missense probably benign 0.00
R7839:Aqp4 UTSW 18 15399680 missense possibly damaging 0.51
R8191:Aqp4 UTSW 18 15398165 missense probably benign
R8206:Aqp4 UTSW 18 15393659 missense possibly damaging 0.88
T0970:Aqp4 UTSW 18 15399883 missense probably damaging 1.00
Z1177:Aqp4 UTSW 18 15399881 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCTGAGTCCAAAGCAAAGG -3'
(R):5'- AAATCACAGGCCTCTCGTCTAC -3'

Sequencing Primer
(F):5'- CAAAGGGAGATGAGGACCATGTC -3'
(R):5'- GGCCTCTCGTCTACTAATTAAGGAG -3'
Posted On2021-04-30