Incidental Mutation 'R8762:Acbd6'
ID671821
Institutional Source Beutler Lab
Gene Symbol Acbd6
Ensembl Gene ENSMUSG00000033701
Gene Nameacyl-Coenzyme A binding domain containing 6
Synonyms0610010G04Rik, 2610100E10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8762 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location155558120-155691330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155686960 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 236 (E236K)
Ref Sequence ENSEMBL: ENSMUSP00000049124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035560]
Predicted Effect probably damaging
Transcript: ENSMUST00000035560
AA Change: E236K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049124
Gene: ENSMUSG00000033701
AA Change: E236K

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:ACBP 43 123 1.5e-26 PFAM
low complexity region 130 148 N/A INTRINSIC
ANK 157 187 2.43e3 SMART
ANK 191 220 8.65e-5 SMART
ANK 224 253 8.19e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192730
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,566,602 N157S probably benign Het
Aarsd1 A G 11: 101,410,400 V272A probably benign Het
Actr1b T C 1: 36,709,828 N9S probably benign Het
Adam17 A T 12: 21,351,594 D133E probably benign Het
Adam6b G A 12: 113,489,607 V15M probably damaging Het
Adam9 T A 8: 24,967,219 N631I probably damaging Het
Amy2a1 A T 3: 113,531,627 probably benign Het
Aplnr A T 2: 85,137,171 Y180F probably benign Het
Arhgef7 T C 8: 11,781,216 V105A probably benign Het
Bambi G A 18: 3,511,277 D33N probably damaging Het
Bicc1 G A 10: 70,943,386 T724I probably benign Het
Brd2 T A 17: 34,116,960 Q93L probably damaging Het
C130060K24Rik T C 6: 65,447,409 V182A probably benign Het
Cacnb2 A G 2: 14,967,948 D222G possibly damaging Het
Ccdc155 G T 7: 45,196,057 D152E probably damaging Het
Cdh1 G T 8: 106,659,704 D420Y probably damaging Het
Cep162 T C 9: 87,227,261 S430G probably benign Het
Cfap161 T A 7: 83,794,074 R27S possibly damaging Het
Chek1 C T 9: 36,718,340 A237T probably benign Het
Chrna3 T A 9: 55,015,711 K271M probably damaging Het
Coro7 A C 16: 4,634,339 V410G probably benign Het
Crmp1 C A 5: 37,284,096 N507K probably damaging Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Disc1 A G 8: 125,155,057 D577G probably damaging Het
Dnah6 A G 6: 73,179,828 Y649H possibly damaging Het
Flywch1 A G 17: 23,756,757 S504P probably damaging Het
Fpr1 A T 17: 17,877,589 V46D probably damaging Het
Fpr-rs7 C T 17: 20,113,527 V234M probably benign Het
Ighv5-16 T C 12: 113,838,668 N71D probably benign Het
Kdm3b A G 18: 34,804,104 M480V probably benign Het
L3mbtl3 T A 10: 26,276,223 D825V probably damaging Het
Lef1 T A 3: 131,194,717 M311K probably damaging Het
Magi1 T A 6: 93,815,808 R150* probably null Het
Magi3 C T 3: 104,050,853 V639I probably damaging Het
Mocos A T 18: 24,679,497 R483W probably damaging Het
Mrps11 G T 7: 78,788,739 V80F possibly damaging Het
Myh2 A T 11: 67,193,752 R1706W probably damaging Het
Neurod6 T A 6: 55,679,243 L136F probably damaging Het
Nfe2l1 A T 11: 96,820,480 Y308N probably damaging Het
Olfr1002 A T 2: 85,647,690 S210R probably damaging Het
Olfr388-ps1 G T 11: 73,724,481 T181N unknown Het
Oscar A G 7: 3,610,901 S227P probably benign Het
Phgdh A C 3: 98,339,708 I42R possibly damaging Het
Pla2g4a C T 1: 149,886,184 G174D probably benign Het
Plcd4 A G 1: 74,552,054 T203A possibly damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Plppr4 A T 3: 117,325,833 V309D probably damaging Het
Pltp T C 2: 164,844,732 K324E possibly damaging Het
Pml C T 9: 58,247,065 R175H probably damaging Het
Psg20 C A 7: 18,674,632 V388F probably benign Het
Rabgef1 A G 5: 130,208,716 D209G possibly damaging Het
Rif1 A T 2: 52,111,730 N90I Het
Sec31a T C 5: 100,378,829 H57R Het
Sidt1 T C 16: 44,332,344 N62S probably benign Het
Slc18a2 T A 19: 59,272,923 M172K probably benign Het
Slc34a3 T C 2: 25,230,991 T362A probably benign Het
Smtn T G 11: 3,526,407 D158A probably benign Het
Spen C T 4: 141,472,950 V2789M probably damaging Het
Taf2 A T 15: 55,047,453 N608K probably benign Het
Tctn3 A G 19: 40,607,192 V383A unknown Het
Themis3 A T 17: 66,559,681 M188K probably benign Het
Trpv5 A G 6: 41,675,379 V124A probably benign Het
Tshr G A 12: 91,537,550 V421M probably damaging Het
Ttn T A 2: 76,709,082 D34520V probably benign Het
Ttn A C 2: 76,777,950 Y17876* probably null Het
Zrsr1 T C 11: 22,973,694 L156P probably benign Het
Other mutations in Acbd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1897:Acbd6 UTSW 1 155558818 missense probably damaging 0.96
R2190:Acbd6 UTSW 1 155624906 missense probably damaging 1.00
R2234:Acbd6 UTSW 1 155558708 missense probably damaging 1.00
R2235:Acbd6 UTSW 1 155558708 missense probably damaging 1.00
R3730:Acbd6 UTSW 1 155558725 missense probably benign 0.24
R3731:Acbd6 UTSW 1 155558725 missense probably benign 0.24
R3888:Acbd6 UTSW 1 155624897 missense probably damaging 1.00
R4349:Acbd6 UTSW 1 155687081 missense probably benign
R4905:Acbd6 UTSW 1 155624923 missense probably benign 0.03
R4983:Acbd6 UTSW 1 155601529 missense probably benign 0.00
R5285:Acbd6 UTSW 1 155558725 missense probably benign 0.24
R5297:Acbd6 UTSW 1 155587458 missense probably benign 0.01
R5955:Acbd6 UTSW 1 155587459 missense probably benign 0.01
R7472:Acbd6 UTSW 1 155587467 nonsense probably null
R7719:Acbd6 UTSW 1 155687012 missense probably damaging 0.99
R7911:Acbd6 UTSW 1 155687004 missense probably damaging 1.00
R7960:Acbd6 UTSW 1 155687020 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGGTCAAAAGTCTCACAGTTTTAC -3'
(R):5'- GCCAAACTGTGCTTCTTCAG -3'

Sequencing Primer
(F):5'- CAAAAGAACTGTGTGTTTCTGTG -3'
(R):5'- TCAGGCTTTGGATCAAGCC -3'
Posted On2021-04-30