Incidental Mutation 'R8762:Rif1'
ID 671824
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Name replication timing regulatory factor 1
Synonyms 6530403D07Rik, 5730435J01Rik, D2Ertd145e
MMRRC Submission 068622-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8762 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 52072832-52122383 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52111730 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 90 (N90I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112693]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112693
AA Change: N1732I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: N1732I

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000152178
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,566,602 (GRCm38) N157S probably benign Het
Aarsd1 A G 11: 101,410,400 (GRCm38) V272A probably benign Het
Acbd6 G A 1: 155,686,960 (GRCm38) E236K probably damaging Het
Actr1b T C 1: 36,709,828 (GRCm38) N9S probably benign Het
Adam17 A T 12: 21,351,594 (GRCm38) D133E probably benign Het
Adam6b G A 12: 113,489,607 (GRCm38) V15M probably damaging Het
Adam9 T A 8: 24,967,219 (GRCm38) N631I probably damaging Het
Amy2a1 A T 3: 113,531,627 (GRCm38) probably benign Het
Aplnr A T 2: 85,137,171 (GRCm38) Y180F probably benign Het
Arhgef7 T C 8: 11,781,216 (GRCm38) V105A probably benign Het
Bambi G A 18: 3,511,277 (GRCm38) D33N probably damaging Het
Bicc1 G A 10: 70,943,386 (GRCm38) T724I probably benign Het
Brd2 T A 17: 34,116,960 (GRCm38) Q93L probably damaging Het
C130060K24Rik T C 6: 65,447,409 (GRCm38) V182A probably benign Het
Cacnb2 A G 2: 14,967,948 (GRCm38) D222G possibly damaging Het
Ccdc155 G T 7: 45,196,057 (GRCm38) D152E probably damaging Het
Cdh1 G T 8: 106,659,704 (GRCm38) D420Y probably damaging Het
Cep162 T C 9: 87,227,261 (GRCm38) S430G probably benign Het
Cfap161 T A 7: 83,794,074 (GRCm38) R27S possibly damaging Het
Chek1 C T 9: 36,718,340 (GRCm38) A237T probably benign Het
Chrna3 T A 9: 55,015,711 (GRCm38) K271M probably damaging Het
Coro7 A C 16: 4,634,339 (GRCm38) V410G probably benign Het
Crmp1 C A 5: 37,284,096 (GRCm38) N507K probably damaging Het
Crocc T C 4: 141,034,058 (GRCm38) R755G possibly damaging Het
Disc1 A G 8: 125,155,057 (GRCm38) D577G probably damaging Het
Dnah6 A G 6: 73,179,828 (GRCm38) Y649H possibly damaging Het
Flywch1 A G 17: 23,756,757 (GRCm38) S504P probably damaging Het
Fpr1 A T 17: 17,877,589 (GRCm38) V46D probably damaging Het
Fpr-rs7 C T 17: 20,113,527 (GRCm38) V234M probably benign Het
Ighv5-16 T C 12: 113,838,668 (GRCm38) N71D probably benign Het
Kdm3b A G 18: 34,804,104 (GRCm38) M480V probably benign Het
L3mbtl3 T A 10: 26,276,223 (GRCm38) D825V probably damaging Het
Lef1 T A 3: 131,194,717 (GRCm38) M311K probably damaging Het
Magi1 T A 6: 93,815,808 (GRCm38) R150* probably null Het
Magi3 C T 3: 104,050,853 (GRCm38) V639I probably damaging Het
Mocos A T 18: 24,679,497 (GRCm38) R483W probably damaging Het
Mrps11 G T 7: 78,788,739 (GRCm38) V80F possibly damaging Het
Myh2 A T 11: 67,193,752 (GRCm38) R1706W probably damaging Het
Neurod6 T A 6: 55,679,243 (GRCm38) L136F probably damaging Het
Nfe2l1 A T 11: 96,820,480 (GRCm38) Y308N probably damaging Het
Nptn T A 9: 58,618,622 (GRCm38) probably benign Het
Olfr1002 A T 2: 85,647,690 (GRCm38) S210R probably damaging Het
Olfr388-ps1 G T 11: 73,724,481 (GRCm38) T181N unknown Het
Oscar A G 7: 3,610,901 (GRCm38) S227P probably benign Het
Phgdh A C 3: 98,339,708 (GRCm38) I42R possibly damaging Het
Pla2g4a C T 1: 149,886,184 (GRCm38) G174D probably benign Het
Plcd4 A G 1: 74,552,054 (GRCm38) T203A possibly damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 (GRCm38) probably benign Het
Plppr4 A T 3: 117,325,833 (GRCm38) V309D probably damaging Het
Pltp T C 2: 164,844,732 (GRCm38) K324E possibly damaging Het
Pml C T 9: 58,247,065 (GRCm38) R175H probably damaging Het
Psg20 C A 7: 18,674,632 (GRCm38) V388F probably benign Het
Rabgef1 A G 5: 130,208,716 (GRCm38) D209G possibly damaging Het
Sec31a T C 5: 100,378,829 (GRCm38) H57R Het
Sidt1 T C 16: 44,332,344 (GRCm38) N62S probably benign Het
Slc18a2 T A 19: 59,272,923 (GRCm38) M172K probably benign Het
Slc34a3 T C 2: 25,230,991 (GRCm38) T362A probably benign Het
Smtn T G 11: 3,526,407 (GRCm38) D158A probably benign Het
Spen C T 4: 141,472,950 (GRCm38) V2789M probably damaging Het
Taf2 A T 15: 55,047,453 (GRCm38) N608K probably benign Het
Tctn3 A G 19: 40,607,192 (GRCm38) V383A unknown Het
Themis3 A T 17: 66,559,681 (GRCm38) M188K probably benign Het
Trpv5 A G 6: 41,675,379 (GRCm38) V124A probably benign Het
Tshr G A 12: 91,537,550 (GRCm38) V421M probably damaging Het
Ttn A C 2: 76,777,950 (GRCm38) Y17876* probably null Het
Ttn T A 2: 76,709,082 (GRCm38) D34520V probably benign Het
Zrsr1 T C 11: 22,973,694 (GRCm38) L156P probably benign Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52,121,007 (GRCm38) missense probably damaging 0.96
IGL00711:Rif1 APN 2 52,111,070 (GRCm38) missense probably benign 0.00
IGL00721:Rif1 APN 2 52,119,117 (GRCm38) missense probably damaging 1.00
IGL01085:Rif1 APN 2 52,085,140 (GRCm38) missense possibly damaging 0.71
IGL01093:Rif1 APN 2 52,095,948 (GRCm38) missense probably damaging 1.00
IGL01107:Rif1 APN 2 52,111,303 (GRCm38) missense probably benign 0.00
IGL01138:Rif1 APN 2 52,111,522 (GRCm38) missense probably damaging 1.00
IGL01844:Rif1 APN 2 52,112,543 (GRCm38) missense probably benign 0.07
IGL02441:Rif1 APN 2 52,105,515 (GRCm38) missense probably benign 0.00
IGL02448:Rif1 APN 2 52,116,696 (GRCm38) missense probably damaging 0.99
IGL02563:Rif1 APN 2 52,077,065 (GRCm38) missense probably damaging 1.00
IGL02704:Rif1 APN 2 52,093,576 (GRCm38) missense probably damaging 1.00
IGL02946:Rif1 APN 2 52,110,125 (GRCm38) nonsense probably null
IGL03060:Rif1 APN 2 52,112,137 (GRCm38) missense probably damaging 0.97
IGL03206:Rif1 APN 2 52,103,622 (GRCm38) missense probably damaging 1.00
IGL03263:Rif1 APN 2 52,090,261 (GRCm38) missense probably damaging 0.99
IGL03267:Rif1 APN 2 52,076,988 (GRCm38) missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52,112,599 (GRCm38) missense probably benign 0.32
hifi UTSW 2 52,110,324 (GRCm38) unclassified probably benign
nietzsche UTSW 2 52,077,020 (GRCm38) missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52,111,958 (GRCm38) missense
R0017:Rif1 UTSW 2 52,116,674 (GRCm38) missense probably benign 0.18
R0017:Rif1 UTSW 2 52,116,674 (GRCm38) missense probably benign 0.18
R0060:Rif1 UTSW 2 52,111,117 (GRCm38) missense probably damaging 1.00
R0060:Rif1 UTSW 2 52,111,117 (GRCm38) missense probably damaging 1.00
R0104:Rif1 UTSW 2 52,110,092 (GRCm38) missense possibly damaging 0.77
R0268:Rif1 UTSW 2 52,090,286 (GRCm38) critical splice donor site probably null
R0276:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0278:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0288:Rif1 UTSW 2 52,110,013 (GRCm38) missense probably damaging 1.00
R0314:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0345:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0346:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0383:Rif1 UTSW 2 52,085,141 (GRCm38) missense probably damaging 0.96
R0384:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0387:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0388:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0456:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0477:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0505:Rif1 UTSW 2 52,110,737 (GRCm38) missense probably damaging 0.99
R0510:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0511:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0512:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0633:Rif1 UTSW 2 52,112,563 (GRCm38) missense probably benign 0.00
R0637:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0638:Rif1 UTSW 2 52,111,588 (GRCm38) missense probably benign 0.12
R0666:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0675:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0707:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0726:Rif1 UTSW 2 52,110,353 (GRCm38) missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0744:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0938:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0939:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0940:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0941:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0942:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R0943:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1006:Rif1 UTSW 2 52,085,029 (GRCm38) missense probably damaging 0.99
R1052:Rif1 UTSW 2 52,111,562 (GRCm38) missense probably benign 0.01
R1061:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1175:Rif1 UTSW 2 52,107,628 (GRCm38) unclassified probably benign
R1183:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1184:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1271:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1332:Rif1 UTSW 2 52,078,314 (GRCm38) missense probably benign 0.06
R1336:Rif1 UTSW 2 52,078,314 (GRCm38) missense probably benign 0.06
R1351:Rif1 UTSW 2 52,111,555 (GRCm38) missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1527:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1560:Rif1 UTSW 2 52,111,131 (GRCm38) missense probably damaging 1.00
R1563:Rif1 UTSW 2 52,073,223 (GRCm38) missense probably damaging 0.99
R1571:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1625:Rif1 UTSW 2 52,103,640 (GRCm38) missense probably benign 0.25
R1679:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1689:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1731:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1744:Rif1 UTSW 2 52,112,392 (GRCm38) missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1748:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R1831:Rif1 UTSW 2 52,078,495 (GRCm38) nonsense probably null
R1902:Rif1 UTSW 2 52,116,673 (GRCm38) missense possibly damaging 0.93
R1964:Rif1 UTSW 2 52,098,409 (GRCm38) missense probably benign 0.01
R1978:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2000:Rif1 UTSW 2 52,081,298 (GRCm38) missense probably damaging 0.99
R2030:Rif1 UTSW 2 52,092,346 (GRCm38) missense probably damaging 1.00
R2056:Rif1 UTSW 2 52,093,576 (GRCm38) missense probably damaging 1.00
R2106:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2109:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2125:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2126:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2145:Rif1 UTSW 2 52,111,400 (GRCm38) missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2153:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2213:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2327:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2512:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2513:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2516:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2520:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R2905:Rif1 UTSW 2 52,098,504 (GRCm38) missense probably damaging 0.99
R3005:Rif1 UTSW 2 52,082,764 (GRCm38) missense probably damaging 1.00
R3155:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R3156:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R3429:Rif1 UTSW 2 52,110,324 (GRCm38) unclassified probably benign
R3707:Rif1 UTSW 2 52,093,580 (GRCm38) missense probably damaging 1.00
R3907:Rif1 UTSW 2 52,112,545 (GRCm38) missense probably benign 0.03
R3978:Rif1 UTSW 2 52,116,747 (GRCm38) critical splice donor site probably null
R4023:Rif1 UTSW 2 52,121,087 (GRCm38) missense probably benign 0.01
R4052:Rif1 UTSW 2 52,098,471 (GRCm38) nonsense probably null
R4668:Rif1 UTSW 2 52,111,952 (GRCm38) missense probably benign 0.01
R4674:Rif1 UTSW 2 52,106,942 (GRCm38) missense probably null 1.00
R4715:Rif1 UTSW 2 52,073,139 (GRCm38) utr 5 prime probably benign
R4766:Rif1 UTSW 2 52,098,934 (GRCm38) missense probably damaging 1.00
R4783:Rif1 UTSW 2 52,112,747 (GRCm38) missense probably damaging 0.96
R4785:Rif1 UTSW 2 52,112,747 (GRCm38) missense probably damaging 0.96
R4869:Rif1 UTSW 2 52,093,611 (GRCm38) intron probably benign
R4911:Rif1 UTSW 2 52,110,518 (GRCm38) missense probably damaging 0.98
R4951:Rif1 UTSW 2 52,084,986 (GRCm38) splice site probably null
R5044:Rif1 UTSW 2 52,109,928 (GRCm38) missense probably damaging 0.99
R5088:Rif1 UTSW 2 52,092,295 (GRCm38) missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52,120,309 (GRCm38) missense probably damaging 1.00
R5187:Rif1 UTSW 2 52,081,289 (GRCm38) missense probably damaging 1.00
R5222:Rif1 UTSW 2 52,077,020 (GRCm38) missense probably benign 0.08
R5243:Rif1 UTSW 2 52,111,824 (GRCm38) missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52,120,971 (GRCm38) intron probably benign
R5476:Rif1 UTSW 2 52,089,595 (GRCm38) missense probably damaging 1.00
R5496:Rif1 UTSW 2 52,098,916 (GRCm38) missense probably damaging 1.00
R5641:Rif1 UTSW 2 52,121,158 (GRCm38) missense possibly damaging 0.80
R5883:Rif1 UTSW 2 52,105,639 (GRCm38) critical splice donor site probably null
R5987:Rif1 UTSW 2 52,095,844 (GRCm38) missense probably damaging 1.00
R5990:Rif1 UTSW 2 52,095,844 (GRCm38) missense probably damaging 1.00
R5992:Rif1 UTSW 2 52,095,844 (GRCm38) missense probably damaging 1.00
R6019:Rif1 UTSW 2 52,095,844 (GRCm38) missense probably damaging 1.00
R6020:Rif1 UTSW 2 52,095,844 (GRCm38) missense probably damaging 1.00
R6255:Rif1 UTSW 2 52,085,053 (GRCm38) missense probably damaging 1.00
R6342:Rif1 UTSW 2 52,119,156 (GRCm38) missense probably damaging 0.97
R6364:Rif1 UTSW 2 52,107,669 (GRCm38) missense probably damaging 0.97
R6747:Rif1 UTSW 2 52,078,263 (GRCm38) splice site probably null
R6928:Rif1 UTSW 2 52,095,961 (GRCm38) missense probably damaging 1.00
R6954:Rif1 UTSW 2 52,112,691 (GRCm38) missense probably benign 0.00
R7003:Rif1 UTSW 2 52,076,989 (GRCm38) missense probably benign 0.06
R7310:Rif1 UTSW 2 52,105,619 (GRCm38) missense probably benign 0.12
R7549:Rif1 UTSW 2 52,078,507 (GRCm38) missense possibly damaging 0.52
R7603:Rif1 UTSW 2 52,076,175 (GRCm38) missense probably damaging 1.00
R7673:Rif1 UTSW 2 52,088,654 (GRCm38) missense probably damaging 1.00
R7741:Rif1 UTSW 2 52,085,141 (GRCm38) missense probably damaging 0.96
R7777:Rif1 UTSW 2 52,116,356 (GRCm38) missense probably benign 0.00
R7910:Rif1 UTSW 2 52,078,387 (GRCm38) nonsense probably null
R7962:Rif1 UTSW 2 52,074,276 (GRCm38) missense probably damaging 1.00
R8264:Rif1 UTSW 2 52,090,278 (GRCm38) missense noncoding transcript
R8390:Rif1 UTSW 2 52,110,923 (GRCm38) missense probably damaging 1.00
R8479:Rif1 UTSW 2 52,112,551 (GRCm38) missense possibly damaging 0.52
R8490:Rif1 UTSW 2 52,110,999 (GRCm38) missense probably damaging 0.96
R8785:Rif1 UTSW 2 52,110,481 (GRCm38) missense probably benign 0.06
R8890:Rif1 UTSW 2 52,098,863 (GRCm38) missense probably damaging 0.99
R9081:Rif1 UTSW 2 52,110,977 (GRCm38) missense probably damaging 0.99
R9225:Rif1 UTSW 2 52,111,850 (GRCm38) missense probably benign 0.22
R9284:Rif1 UTSW 2 52,108,552 (GRCm38) missense probably benign 0.00
R9300:Rif1 UTSW 2 52,111,139 (GRCm38) missense probably damaging 1.00
R9366:Rif1 UTSW 2 52,120,344 (GRCm38) missense
R9477:Rif1 UTSW 2 52,111,330 (GRCm38) missense probably benign 0.02
R9522:Rif1 UTSW 2 52,081,299 (GRCm38) missense probably damaging 1.00
R9573:Rif1 UTSW 2 52,110,454 (GRCm38) missense probably benign 0.29
R9630:Rif1 UTSW 2 52,089,595 (GRCm38) missense probably damaging 1.00
X0064:Rif1 UTSW 2 52,094,633 (GRCm38) missense probably damaging 0.96
X0064:Rif1 UTSW 2 52,074,315 (GRCm38) missense probably benign 0.00
Z1177:Rif1 UTSW 2 52,088,648 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGGACTAGGAATGCCAGTAAG -3'
(R):5'- CTTGCAACTCAGCCTCAGAC -3'

Sequencing Primer
(F):5'- TCACCCAAGTTGAATGCC -3'
(R):5'- TCAGACTTAACTGAATCACCAGTAG -3'
Posted On 2021-04-30