Incidental Mutation 'R8762:Cep162'
ID671859
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R8762 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87227261 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 430 (S430G)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect probably benign
Transcript: ENSMUST00000093802
AA Change: S430G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: S430G

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,566,602 N157S probably benign Het
Aarsd1 A G 11: 101,410,400 V272A probably benign Het
Acbd6 G A 1: 155,686,960 E236K probably damaging Het
Actr1b T C 1: 36,709,828 N9S probably benign Het
Adam17 A T 12: 21,351,594 D133E probably benign Het
Adam6b G A 12: 113,489,607 V15M probably damaging Het
Adam9 T A 8: 24,967,219 N631I probably damaging Het
Amy2a1 A T 3: 113,531,627 probably benign Het
Aplnr A T 2: 85,137,171 Y180F probably benign Het
Arhgef7 T C 8: 11,781,216 V105A probably benign Het
Bambi G A 18: 3,511,277 D33N probably damaging Het
Bicc1 G A 10: 70,943,386 T724I probably benign Het
Brd2 T A 17: 34,116,960 Q93L probably damaging Het
C130060K24Rik T C 6: 65,447,409 V182A probably benign Het
Cacnb2 A G 2: 14,967,948 D222G possibly damaging Het
Ccdc155 G T 7: 45,196,057 D152E probably damaging Het
Cdh1 G T 8: 106,659,704 D420Y probably damaging Het
Cfap161 T A 7: 83,794,074 R27S possibly damaging Het
Chek1 C T 9: 36,718,340 A237T probably benign Het
Chrna3 T A 9: 55,015,711 K271M probably damaging Het
Coro7 A C 16: 4,634,339 V410G probably benign Het
Crmp1 C A 5: 37,284,096 N507K probably damaging Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Disc1 A G 8: 125,155,057 D577G probably damaging Het
Dnah6 A G 6: 73,179,828 Y649H possibly damaging Het
Flywch1 A G 17: 23,756,757 S504P probably damaging Het
Fpr1 A T 17: 17,877,589 V46D probably damaging Het
Fpr-rs7 C T 17: 20,113,527 V234M probably benign Het
Ighv5-16 T C 12: 113,838,668 N71D probably benign Het
Kdm3b A G 18: 34,804,104 M480V probably benign Het
L3mbtl3 T A 10: 26,276,223 D825V probably damaging Het
Lef1 T A 3: 131,194,717 M311K probably damaging Het
Magi1 T A 6: 93,815,808 R150* probably null Het
Magi3 C T 3: 104,050,853 V639I probably damaging Het
Mocos A T 18: 24,679,497 R483W probably damaging Het
Mrps11 G T 7: 78,788,739 V80F possibly damaging Het
Myh2 A T 11: 67,193,752 R1706W probably damaging Het
Neurod6 T A 6: 55,679,243 L136F probably damaging Het
Nfe2l1 A T 11: 96,820,480 Y308N probably damaging Het
Olfr1002 A T 2: 85,647,690 S210R probably damaging Het
Olfr388-ps1 G T 11: 73,724,481 T181N unknown Het
Oscar A G 7: 3,610,901 S227P probably benign Het
Phgdh A C 3: 98,339,708 I42R possibly damaging Het
Pla2g4a C T 1: 149,886,184 G174D probably benign Het
Plcd4 A G 1: 74,552,054 T203A possibly damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Plppr4 A T 3: 117,325,833 V309D probably damaging Het
Pltp T C 2: 164,844,732 K324E possibly damaging Het
Pml C T 9: 58,247,065 R175H probably damaging Het
Psg20 C A 7: 18,674,632 V388F probably benign Het
Rabgef1 A G 5: 130,208,716 D209G possibly damaging Het
Rif1 A T 2: 52,111,730 N90I Het
Sec31a T C 5: 100,378,829 H57R Het
Sidt1 T C 16: 44,332,344 N62S probably benign Het
Slc18a2 T A 19: 59,272,923 M172K probably benign Het
Slc34a3 T C 2: 25,230,991 T362A probably benign Het
Smtn T G 11: 3,526,407 D158A probably benign Het
Spen C T 4: 141,472,950 V2789M probably damaging Het
Taf2 A T 15: 55,047,453 N608K probably benign Het
Tctn3 A G 19: 40,607,192 V383A unknown Het
Themis3 A T 17: 66,559,681 M188K probably benign Het
Trpv5 A G 6: 41,675,379 V124A probably benign Het
Tshr G A 12: 91,537,550 V421M probably damaging Het
Ttn T A 2: 76,709,082 D34520V probably benign Het
Ttn A C 2: 76,777,950 Y17876* probably null Het
Zrsr1 T C 11: 22,973,694 L156P probably benign Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
circus UTSW 9 87206862 missense probably damaging 1.00
moscow UTSW 9 87193697 missense probably damaging 1.00
smiley UTSW 9 87217081 nonsense probably null
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87244345 missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R0764:Cep162 UTSW 9 87201745 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1847:Cep162 UTSW 9 87204080 missense probably benign 0.06
R1941:Cep162 UTSW 9 87199995 missense probably benign 0.14
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2257:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4450:Cep162 UTSW 9 87225808 missense probably damaging 1.00
R4540:Cep162 UTSW 9 87212939 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6422:Cep162 UTSW 9 87232016 missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6576:Cep162 UTSW 9 87217145 missense probably benign 0.01
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
R7426:Cep162 UTSW 9 87192766 missense probably damaging 1.00
R7593:Cep162 UTSW 9 87204197 missense probably benign 0.40
R7710:Cep162 UTSW 9 87232119 missense probably damaging 1.00
R7841:Cep162 UTSW 9 87244316 missense probably benign 0.00
R7949:Cep162 UTSW 9 87206848 missense probably benign 0.04
R8351:Cep162 UTSW 9 87192850 nonsense probably null
R8451:Cep162 UTSW 9 87192850 nonsense probably null
R8552:Cep162 UTSW 9 87244308 missense probably benign 0.34
R8755:Cep162 UTSW 9 87232011 missense probably benign 0.02
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Z1177:Cep162 UTSW 9 87199980 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTAATAAGGCCCACCCAC -3'
(R):5'- CTGAGGAATTCATGCTACCTTCAG -3'

Sequencing Primer
(F):5'- CAGGAAAGACAGCACCCAAAGATG -3'
(R):5'- GCTCTGTTTTATTCTGTAGCCTTAAG -3'
Posted On2021-04-30