Incidental Mutation 'R8762:Smtn'
ID 671862
Institutional Source Beutler Lab
Gene Symbol Smtn
Ensembl Gene ENSMUSG00000020439
Gene Name smoothelin
Synonyms
MMRRC Submission 068622-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.515) question?
Stock # R8762 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 3467522-3489337 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 3476407 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 158 (D158A)
Ref Sequence ENSEMBL: ENSMUSP00000020718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020718] [ENSMUST00000020721] [ENSMUST00000075118] [ENSMUST00000110011] [ENSMUST00000170588]
AlphaFold Q921U8
Predicted Effect probably benign
Transcript: ENSMUST00000020718
AA Change: D158A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000020718
Gene: ENSMUSG00000020439
AA Change: D158A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
coiled coil region 41 74 N/A INTRINSIC
low complexity region 75 100 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
Pfam:Smoothelin 154 208 1e-23 PFAM
low complexity region 212 236 N/A INTRINSIC
CH 322 421 1.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020721
AA Change: D567A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020721
Gene: ENSMUSG00000020439
AA Change: D567A

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075118
AA Change: D567A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074621
Gene: ENSMUSG00000020439
AA Change: D567A

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.8e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 907 9.51e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110011
AA Change: D567A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105638
Gene: ENSMUSG00000020439
AA Change: D567A

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.5e-14 PFAM
Pfam:Smoothelin 72 122 8.5e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 568 617 6e-25 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 930 1.62e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170588
AA Change: D567A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133155
Gene: ENSMUSG00000020439
AA Change: D567A

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions of both the A and B isoforms of this gene display partial postnatal lethality, impaired intestinal smooth muscle contractility and thus hampered intestinal transit and diverticulosis. Mice lacking only the B isoform appearnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A G 11: 101,301,226 (GRCm39) V272A probably benign Het
Acbd6 G A 1: 155,562,706 (GRCm39) E236K probably damaging Het
Actr1b T C 1: 36,748,909 (GRCm39) N9S probably benign Het
Adam17 A T 12: 21,401,595 (GRCm39) D133E probably benign Het
Adam6b G A 12: 113,453,227 (GRCm39) V15M probably damaging Het
Adam9 T A 8: 25,457,235 (GRCm39) N631I probably damaging Het
Albfm1 A G 5: 90,714,461 (GRCm39) N157S probably benign Het
Amy2a1 A T 3: 113,325,276 (GRCm39) probably benign Het
Aplnr A T 2: 84,967,515 (GRCm39) Y180F probably benign Het
Arhgef7 T C 8: 11,831,216 (GRCm39) V105A probably benign Het
Bambi G A 18: 3,511,277 (GRCm39) D33N probably damaging Het
Bicc1 G A 10: 70,779,216 (GRCm39) T724I probably benign Het
Brd2 T A 17: 34,335,934 (GRCm39) Q93L probably damaging Het
Cacnb2 A G 2: 14,972,759 (GRCm39) D222G possibly damaging Het
Cdh1 G T 8: 107,386,336 (GRCm39) D420Y probably damaging Het
Cep162 T C 9: 87,109,314 (GRCm39) S430G probably benign Het
Cfap161 T A 7: 83,443,282 (GRCm39) R27S possibly damaging Het
Chek1 C T 9: 36,629,636 (GRCm39) A237T probably benign Het
Chrna3 T A 9: 54,922,995 (GRCm39) K271M probably damaging Het
Coro7 A C 16: 4,452,203 (GRCm39) V410G probably benign Het
Crmp1 C A 5: 37,441,440 (GRCm39) N507K probably damaging Het
Crocc T C 4: 140,761,369 (GRCm39) R755G possibly damaging Het
Disc1 A G 8: 125,881,796 (GRCm39) D577G probably damaging Het
Dnah6 A G 6: 73,156,811 (GRCm39) Y649H possibly damaging Het
Flywch1 A G 17: 23,975,731 (GRCm39) S504P probably damaging Het
Fpr1 A T 17: 18,097,851 (GRCm39) V46D probably damaging Het
Fpr-rs7 C T 17: 20,333,789 (GRCm39) V234M probably benign Het
Ighv5-16 T C 12: 113,802,288 (GRCm39) N71D probably benign Het
Kash5 G T 7: 44,845,481 (GRCm39) D152E probably damaging Het
Kdm3b A G 18: 34,937,157 (GRCm39) M480V probably benign Het
L3mbtl3 T A 10: 26,152,121 (GRCm39) D825V probably damaging Het
Lef1 T A 3: 130,988,366 (GRCm39) M311K probably damaging Het
Magi1 T A 6: 93,792,789 (GRCm39) R150* probably null Het
Magi3 C T 3: 103,958,169 (GRCm39) V639I probably damaging Het
Mocos A T 18: 24,812,554 (GRCm39) R483W probably damaging Het
Mrps11 G T 7: 78,438,487 (GRCm39) V80F possibly damaging Het
Myh2 A T 11: 67,084,578 (GRCm39) R1706W probably damaging Het
Neurod6 T A 6: 55,656,228 (GRCm39) L136F probably damaging Het
Nfe2l1 A T 11: 96,711,306 (GRCm39) Y308N probably damaging Het
Nptn T A 9: 58,525,905 (GRCm39) probably benign Het
Or1e28-ps1 G T 11: 73,615,307 (GRCm39) T181N unknown Het
Or5g25 A T 2: 85,478,034 (GRCm39) S210R probably damaging Het
Oscar A G 7: 3,613,900 (GRCm39) S227P probably benign Het
Phgdh A C 3: 98,247,024 (GRCm39) I42R possibly damaging Het
Pla2g4a C T 1: 149,761,935 (GRCm39) G174D probably benign Het
Plcd4 A G 1: 74,591,213 (GRCm39) T203A possibly damaging Het
Plk3 ACACTCAC ACAC 4: 116,989,090 (GRCm39) probably benign Het
Plppr4 A T 3: 117,119,482 (GRCm39) V309D probably damaging Het
Pltp T C 2: 164,686,652 (GRCm39) K324E possibly damaging Het
Pml C T 9: 58,154,348 (GRCm39) R175H probably damaging Het
Psg20 C A 7: 18,408,557 (GRCm39) V388F probably benign Het
Qrfprl T C 6: 65,424,393 (GRCm39) V182A probably benign Het
Rabgef1 A G 5: 130,237,557 (GRCm39) D209G possibly damaging Het
Rif1 A T 2: 52,001,742 (GRCm39) N90I Het
Sec31a T C 5: 100,526,688 (GRCm39) H57R Het
Sidt1 T C 16: 44,152,707 (GRCm39) N62S probably benign Het
Slc18a2 T A 19: 59,261,355 (GRCm39) M172K probably benign Het
Slc34a3 T C 2: 25,121,003 (GRCm39) T362A probably benign Het
Spen C T 4: 141,200,261 (GRCm39) V2789M probably damaging Het
Taf2 A T 15: 54,910,849 (GRCm39) N608K probably benign Het
Tctn3 A G 19: 40,595,636 (GRCm39) V383A unknown Het
Themis3 A T 17: 66,866,676 (GRCm39) M188K probably benign Het
Trpv5 A G 6: 41,652,313 (GRCm39) V124A probably benign Het
Tshr G A 12: 91,504,324 (GRCm39) V421M probably damaging Het
Ttn T A 2: 76,539,426 (GRCm39) D34520V probably benign Het
Ttn A C 2: 76,608,294 (GRCm39) Y17876* probably null Het
Zrsr2-ps1 T C 11: 22,923,694 (GRCm39) L156P probably benign Het
Other mutations in Smtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Smtn APN 11 3,476,326 (GRCm39) critical splice donor site probably null
IGL02335:Smtn APN 11 3,476,215 (GRCm39) missense probably damaging 1.00
IGL02473:Smtn APN 11 3,482,463 (GRCm39) missense probably damaging 1.00
IGL02678:Smtn APN 11 3,476,353 (GRCm39) missense possibly damaging 0.95
IGL02824:Smtn APN 11 3,482,658 (GRCm39) missense probably damaging 1.00
IGL03067:Smtn APN 11 3,480,165 (GRCm39) missense possibly damaging 0.53
IGL03142:Smtn APN 11 3,482,601 (GRCm39) nonsense probably null
runtish UTSW 11 3,481,326 (GRCm39) missense possibly damaging 0.89
R0279:Smtn UTSW 11 3,480,235 (GRCm39) missense probably damaging 0.99
R0523:Smtn UTSW 11 3,474,664 (GRCm39) missense possibly damaging 0.89
R0855:Smtn UTSW 11 3,471,880 (GRCm39) missense probably damaging 1.00
R1080:Smtn UTSW 11 3,467,693 (GRCm39) missense probably damaging 1.00
R1218:Smtn UTSW 11 3,480,021 (GRCm39) missense probably benign
R1571:Smtn UTSW 11 3,480,102 (GRCm39) missense probably benign 0.00
R1899:Smtn UTSW 11 3,481,326 (GRCm39) missense possibly damaging 0.89
R2033:Smtn UTSW 11 3,467,781 (GRCm39) missense probably benign 0.43
R2126:Smtn UTSW 11 3,480,045 (GRCm39) missense probably benign 0.02
R2358:Smtn UTSW 11 3,482,865 (GRCm39) splice site probably null
R3690:Smtn UTSW 11 3,477,687 (GRCm39) intron probably benign
R3712:Smtn UTSW 11 3,482,865 (GRCm39) splice site probably null
R4108:Smtn UTSW 11 3,476,449 (GRCm39) missense probably benign 0.10
R4709:Smtn UTSW 11 3,474,663 (GRCm39) missense probably damaging 0.99
R4710:Smtn UTSW 11 3,474,663 (GRCm39) missense probably damaging 0.99
R4830:Smtn UTSW 11 3,470,736 (GRCm39) intron probably benign
R4944:Smtn UTSW 11 3,472,916 (GRCm39) missense probably damaging 1.00
R4959:Smtn UTSW 11 3,477,825 (GRCm39) start codon destroyed probably null
R5223:Smtn UTSW 11 3,479,530 (GRCm39) missense probably benign 0.00
R5554:Smtn UTSW 11 3,470,811 (GRCm39) nonsense probably null
R5610:Smtn UTSW 11 3,479,582 (GRCm39) missense probably damaging 1.00
R5636:Smtn UTSW 11 3,467,829 (GRCm39) critical splice acceptor site probably null
R5972:Smtn UTSW 11 3,483,486 (GRCm39) missense probably damaging 1.00
R6108:Smtn UTSW 11 3,479,608 (GRCm39) missense probably damaging 0.99
R6227:Smtn UTSW 11 3,477,624 (GRCm39) intron probably benign
R7016:Smtn UTSW 11 3,480,368 (GRCm39) critical splice donor site probably null
R7423:Smtn UTSW 11 3,481,200 (GRCm39) critical splice donor site probably null
R7426:Smtn UTSW 11 3,480,249 (GRCm39) missense probably benign 0.10
R7447:Smtn UTSW 11 3,480,196 (GRCm39) missense probably benign
R7496:Smtn UTSW 11 3,479,988 (GRCm39) missense probably damaging 0.99
R7716:Smtn UTSW 11 3,474,708 (GRCm39) missense probably benign 0.00
R8925:Smtn UTSW 11 3,479,477 (GRCm39) missense possibly damaging 0.68
R8927:Smtn UTSW 11 3,479,477 (GRCm39) missense possibly damaging 0.68
R8932:Smtn UTSW 11 3,472,908 (GRCm39) missense probably benign 0.01
R9137:Smtn UTSW 11 3,472,838 (GRCm39) missense possibly damaging 0.93
R9502:Smtn UTSW 11 3,482,780 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAAGTTCGTAGTCTGGTCCAG -3'
(R):5'- GCCAACCTATATTAGCAGGCC -3'

Sequencing Primer
(F):5'- TCTGGTCCAGCTGTAGACAGAG -3'
(R):5'- ACCTATATTAGCAGGCCTGGCAG -3'
Posted On 2021-04-30