Incidental Mutation 'R8762:Myh2'
ID 671864
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Name myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms Myhs-f, Myhsf1, MHC2A, Myhs-f1, MyHC-IIa
MMRRC Submission 068622-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.228) question?
Stock # R8762 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 67061853-67088343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67084578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1706 (R1706W)
Ref Sequence ENSEMBL: ENSMUSP00000018641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
AlphaFold G3UW82
Predicted Effect probably damaging
Transcript: ENSMUST00000018641
AA Change: R1706W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: R1706W

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170159
AA Change: R1706W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: R1706W

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A G 11: 101,301,226 (GRCm39) V272A probably benign Het
Acbd6 G A 1: 155,562,706 (GRCm39) E236K probably damaging Het
Actr1b T C 1: 36,748,909 (GRCm39) N9S probably benign Het
Adam17 A T 12: 21,401,595 (GRCm39) D133E probably benign Het
Adam6b G A 12: 113,453,227 (GRCm39) V15M probably damaging Het
Adam9 T A 8: 25,457,235 (GRCm39) N631I probably damaging Het
Albfm1 A G 5: 90,714,461 (GRCm39) N157S probably benign Het
Amy2a1 A T 3: 113,325,276 (GRCm39) probably benign Het
Aplnr A T 2: 84,967,515 (GRCm39) Y180F probably benign Het
Arhgef7 T C 8: 11,831,216 (GRCm39) V105A probably benign Het
Bambi G A 18: 3,511,277 (GRCm39) D33N probably damaging Het
Bicc1 G A 10: 70,779,216 (GRCm39) T724I probably benign Het
Brd2 T A 17: 34,335,934 (GRCm39) Q93L probably damaging Het
Cacnb2 A G 2: 14,972,759 (GRCm39) D222G possibly damaging Het
Cdh1 G T 8: 107,386,336 (GRCm39) D420Y probably damaging Het
Cep162 T C 9: 87,109,314 (GRCm39) S430G probably benign Het
Cfap161 T A 7: 83,443,282 (GRCm39) R27S possibly damaging Het
Chek1 C T 9: 36,629,636 (GRCm39) A237T probably benign Het
Chrna3 T A 9: 54,922,995 (GRCm39) K271M probably damaging Het
Coro7 A C 16: 4,452,203 (GRCm39) V410G probably benign Het
Crmp1 C A 5: 37,441,440 (GRCm39) N507K probably damaging Het
Crocc T C 4: 140,761,369 (GRCm39) R755G possibly damaging Het
Disc1 A G 8: 125,881,796 (GRCm39) D577G probably damaging Het
Dnah6 A G 6: 73,156,811 (GRCm39) Y649H possibly damaging Het
Flywch1 A G 17: 23,975,731 (GRCm39) S504P probably damaging Het
Fpr1 A T 17: 18,097,851 (GRCm39) V46D probably damaging Het
Fpr-rs7 C T 17: 20,333,789 (GRCm39) V234M probably benign Het
Ighv5-16 T C 12: 113,802,288 (GRCm39) N71D probably benign Het
Kash5 G T 7: 44,845,481 (GRCm39) D152E probably damaging Het
Kdm3b A G 18: 34,937,157 (GRCm39) M480V probably benign Het
L3mbtl3 T A 10: 26,152,121 (GRCm39) D825V probably damaging Het
Lef1 T A 3: 130,988,366 (GRCm39) M311K probably damaging Het
Magi1 T A 6: 93,792,789 (GRCm39) R150* probably null Het
Magi3 C T 3: 103,958,169 (GRCm39) V639I probably damaging Het
Mocos A T 18: 24,812,554 (GRCm39) R483W probably damaging Het
Mrps11 G T 7: 78,438,487 (GRCm39) V80F possibly damaging Het
Neurod6 T A 6: 55,656,228 (GRCm39) L136F probably damaging Het
Nfe2l1 A T 11: 96,711,306 (GRCm39) Y308N probably damaging Het
Nptn T A 9: 58,525,905 (GRCm39) probably benign Het
Or1e28-ps1 G T 11: 73,615,307 (GRCm39) T181N unknown Het
Or5g25 A T 2: 85,478,034 (GRCm39) S210R probably damaging Het
Oscar A G 7: 3,613,900 (GRCm39) S227P probably benign Het
Phgdh A C 3: 98,247,024 (GRCm39) I42R possibly damaging Het
Pla2g4a C T 1: 149,761,935 (GRCm39) G174D probably benign Het
Plcd4 A G 1: 74,591,213 (GRCm39) T203A possibly damaging Het
Plk3 ACACTCAC ACAC 4: 116,989,090 (GRCm39) probably benign Het
Plppr4 A T 3: 117,119,482 (GRCm39) V309D probably damaging Het
Pltp T C 2: 164,686,652 (GRCm39) K324E possibly damaging Het
Pml C T 9: 58,154,348 (GRCm39) R175H probably damaging Het
Psg20 C A 7: 18,408,557 (GRCm39) V388F probably benign Het
Qrfprl T C 6: 65,424,393 (GRCm39) V182A probably benign Het
Rabgef1 A G 5: 130,237,557 (GRCm39) D209G possibly damaging Het
Rif1 A T 2: 52,001,742 (GRCm39) N90I Het
Sec31a T C 5: 100,526,688 (GRCm39) H57R Het
Sidt1 T C 16: 44,152,707 (GRCm39) N62S probably benign Het
Slc18a2 T A 19: 59,261,355 (GRCm39) M172K probably benign Het
Slc34a3 T C 2: 25,121,003 (GRCm39) T362A probably benign Het
Smtn T G 11: 3,476,407 (GRCm39) D158A probably benign Het
Spen C T 4: 141,200,261 (GRCm39) V2789M probably damaging Het
Taf2 A T 15: 54,910,849 (GRCm39) N608K probably benign Het
Tctn3 A G 19: 40,595,636 (GRCm39) V383A unknown Het
Themis3 A T 17: 66,866,676 (GRCm39) M188K probably benign Het
Trpv5 A G 6: 41,652,313 (GRCm39) V124A probably benign Het
Tshr G A 12: 91,504,324 (GRCm39) V421M probably damaging Het
Ttn T A 2: 76,539,426 (GRCm39) D34520V probably benign Het
Ttn A C 2: 76,608,294 (GRCm39) Y17876* probably null Het
Zrsr2-ps1 T C 11: 22,923,694 (GRCm39) L156P probably benign Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67,076,059 (GRCm39) missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67,084,266 (GRCm39) missense probably benign 0.06
IGL00423:Myh2 APN 11 67,088,171 (GRCm39) missense probably benign
IGL00429:Myh2 APN 11 67,071,616 (GRCm39) nonsense probably null
IGL00465:Myh2 APN 11 67,069,659 (GRCm39) splice site probably benign
IGL00671:Myh2 APN 11 67,084,183 (GRCm39) missense probably damaging 0.97
IGL00773:Myh2 APN 11 67,085,247 (GRCm39) missense probably benign
IGL00821:Myh2 APN 11 67,088,223 (GRCm39) utr 3 prime probably benign
IGL00900:Myh2 APN 11 67,070,210 (GRCm39) missense probably damaging 1.00
IGL01374:Myh2 APN 11 67,068,250 (GRCm39) missense probably benign 0.05
IGL01613:Myh2 APN 11 67,088,170 (GRCm39) missense probably benign 0.01
IGL01845:Myh2 APN 11 67,083,860 (GRCm39) missense probably benign 0.02
IGL01900:Myh2 APN 11 67,074,609 (GRCm39) missense probably benign 0.01
IGL01936:Myh2 APN 11 67,082,599 (GRCm39) missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67,076,084 (GRCm39) missense probably benign 0.05
IGL02172:Myh2 APN 11 67,079,878 (GRCm39) missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67,079,991 (GRCm39) missense probably benign 0.00
IGL02578:Myh2 APN 11 67,077,517 (GRCm39) missense probably benign 0.33
IGL03075:Myh2 APN 11 67,071,662 (GRCm39) missense probably benign 0.39
IGL03078:Myh2 APN 11 67,081,256 (GRCm39) missense probably benign
IGL03117:Myh2 APN 11 67,071,710 (GRCm39) missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67,084,051 (GRCm39) missense probably damaging 1.00
IGL03266:Myh2 APN 11 67,067,150 (GRCm39) missense probably benign
IGL03366:Myh2 APN 11 67,074,349 (GRCm39) missense probably damaging 1.00
IGL03412:Myh2 APN 11 67,080,395 (GRCm39) missense probably benign 0.04
limp UTSW 11 67,083,330 (GRCm39) missense probably damaging 1.00
noodle UTSW 11 67,077,438 (GRCm39) missense probably benign
PIT4403001:Myh2 UTSW 11 67,077,533 (GRCm39) missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67,076,331 (GRCm39) missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67,072,818 (GRCm39) missense probably benign
R0039:Myh2 UTSW 11 67,069,103 (GRCm39) missense probably damaging 1.00
R0347:Myh2 UTSW 11 67,076,130 (GRCm39) splice site probably benign
R0389:Myh2 UTSW 11 67,071,647 (GRCm39) missense probably damaging 1.00
R0400:Myh2 UTSW 11 67,083,424 (GRCm39) splice site probably benign
R0512:Myh2 UTSW 11 67,079,504 (GRCm39) missense probably damaging 1.00
R0555:Myh2 UTSW 11 67,069,793 (GRCm39) missense probably damaging 1.00
R0746:Myh2 UTSW 11 67,064,257 (GRCm39) missense probably benign 0.00
R0842:Myh2 UTSW 11 67,070,350 (GRCm39) missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67,077,334 (GRCm39) missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67,083,351 (GRCm39) missense probably damaging 0.99
R1264:Myh2 UTSW 11 67,071,604 (GRCm39) missense probably damaging 0.96
R1398:Myh2 UTSW 11 67,076,113 (GRCm39) missense probably benign 0.14
R1774:Myh2 UTSW 11 67,064,300 (GRCm39) missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67,079,764 (GRCm39) missense probably damaging 0.99
R1829:Myh2 UTSW 11 67,067,385 (GRCm39) missense probably damaging 0.98
R1840:Myh2 UTSW 11 67,077,313 (GRCm39) missense probably benign 0.16
R1888:Myh2 UTSW 11 67,071,676 (GRCm39) missense probably damaging 0.99
R1888:Myh2 UTSW 11 67,071,676 (GRCm39) missense probably damaging 0.99
R1969:Myh2 UTSW 11 67,080,004 (GRCm39) missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67,080,004 (GRCm39) missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67,071,740 (GRCm39) missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67,082,545 (GRCm39) missense probably damaging 1.00
R2029:Myh2 UTSW 11 67,085,451 (GRCm39) missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67,079,665 (GRCm39) critical splice donor site probably null
R2080:Myh2 UTSW 11 67,065,767 (GRCm39) critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67,080,158 (GRCm39) missense probably damaging 1.00
R2215:Myh2 UTSW 11 67,082,563 (GRCm39) missense probably benign 0.35
R2225:Myh2 UTSW 11 67,084,555 (GRCm39) missense probably benign
R2274:Myh2 UTSW 11 67,081,184 (GRCm39) missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67,070,410 (GRCm39) missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67,076,012 (GRCm39) missense probably damaging 1.00
R3703:Myh2 UTSW 11 67,080,427 (GRCm39) missense probably benign 0.01
R4022:Myh2 UTSW 11 67,070,230 (GRCm39) nonsense probably null
R4081:Myh2 UTSW 11 67,081,256 (GRCm39) missense probably benign 0.11
R4191:Myh2 UTSW 11 67,068,226 (GRCm39) missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67,071,985 (GRCm39) missense probably benign 0.01
R4292:Myh2 UTSW 11 67,085,723 (GRCm39) missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67,083,551 (GRCm39) missense probably benign 0.01
R4524:Myh2 UTSW 11 67,067,096 (GRCm39) missense probably damaging 1.00
R4578:Myh2 UTSW 11 67,064,084 (GRCm39) missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67,080,244 (GRCm39) missense probably benign 0.01
R4641:Myh2 UTSW 11 67,085,520 (GRCm39) missense probably damaging 1.00
R4672:Myh2 UTSW 11 67,079,303 (GRCm39) missense probably damaging 1.00
R4673:Myh2 UTSW 11 67,079,303 (GRCm39) missense probably damaging 1.00
R4804:Myh2 UTSW 11 67,077,328 (GRCm39) missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67,067,081 (GRCm39) missense probably damaging 1.00
R4943:Myh2 UTSW 11 67,088,143 (GRCm39) missense probably damaging 1.00
R4958:Myh2 UTSW 11 67,083,785 (GRCm39) missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67,070,174 (GRCm39) missense probably damaging 1.00
R5239:Myh2 UTSW 11 67,083,269 (GRCm39) missense probably benign 0.00
R5306:Myh2 UTSW 11 67,077,382 (GRCm39) missense probably damaging 1.00
R5492:Myh2 UTSW 11 67,071,701 (GRCm39) missense probably benign 0.20
R5503:Myh2 UTSW 11 67,064,275 (GRCm39) missense probably benign
R5646:Myh2 UTSW 11 67,079,638 (GRCm39) missense probably benign 0.07
R5750:Myh2 UTSW 11 67,082,254 (GRCm39) missense probably benign
R5806:Myh2 UTSW 11 67,072,141 (GRCm39) missense probably damaging 0.98
R5878:Myh2 UTSW 11 67,083,330 (GRCm39) missense probably damaging 1.00
R5892:Myh2 UTSW 11 67,076,002 (GRCm39) nonsense probably null
R5898:Myh2 UTSW 11 67,083,545 (GRCm39) missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67,077,438 (GRCm39) missense probably benign
R6156:Myh2 UTSW 11 67,071,879 (GRCm39) missense probably damaging 0.98
R6236:Myh2 UTSW 11 67,081,157 (GRCm39) missense probably benign 0.00
R6349:Myh2 UTSW 11 67,083,829 (GRCm39) missense probably benign 0.04
R6441:Myh2 UTSW 11 67,085,437 (GRCm39) missense probably benign 0.00
R6548:Myh2 UTSW 11 67,077,438 (GRCm39) missense probably benign
R6681:Myh2 UTSW 11 67,069,174 (GRCm39) missense probably damaging 1.00
R6907:Myh2 UTSW 11 67,084,567 (GRCm39) missense probably damaging 1.00
R6925:Myh2 UTSW 11 67,084,044 (GRCm39) missense probably benign 0.00
R6969:Myh2 UTSW 11 67,088,092 (GRCm39) missense probably benign
R7172:Myh2 UTSW 11 67,079,527 (GRCm39) missense probably benign 0.00
R7257:Myh2 UTSW 11 67,071,976 (GRCm39) missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67,079,195 (GRCm39) missense probably benign 0.23
R7323:Myh2 UTSW 11 67,088,191 (GRCm39) missense probably benign
R7396:Myh2 UTSW 11 67,085,554 (GRCm39) critical splice donor site probably null
R7468:Myh2 UTSW 11 67,083,368 (GRCm39) missense probably benign 0.01
R7585:Myh2 UTSW 11 67,070,237 (GRCm39) critical splice donor site probably null
R7709:Myh2 UTSW 11 67,085,690 (GRCm39) missense probably benign 0.00
R7859:Myh2 UTSW 11 67,077,526 (GRCm39) missense probably damaging 0.96
R7908:Myh2 UTSW 11 67,088,197 (GRCm39) missense probably benign
R8062:Myh2 UTSW 11 67,084,209 (GRCm39) nonsense probably null
R8065:Myh2 UTSW 11 67,072,170 (GRCm39) missense probably null 0.01
R8093:Myh2 UTSW 11 67,079,536 (GRCm39) missense probably damaging 1.00
R8123:Myh2 UTSW 11 67,064,135 (GRCm39) missense probably benign
R8235:Myh2 UTSW 11 67,083,824 (GRCm39) missense probably damaging 1.00
R8512:Myh2 UTSW 11 67,081,187 (GRCm39) missense probably benign 0.11
R8777:Myh2 UTSW 11 67,083,398 (GRCm39) missense possibly damaging 0.67
R8777-TAIL:Myh2 UTSW 11 67,083,398 (GRCm39) missense possibly damaging 0.67
R8823:Myh2 UTSW 11 67,076,300 (GRCm39) missense probably damaging 1.00
R8927:Myh2 UTSW 11 67,079,509 (GRCm39) missense probably benign 0.00
R8928:Myh2 UTSW 11 67,079,509 (GRCm39) missense probably benign 0.00
R8978:Myh2 UTSW 11 67,080,323 (GRCm39) missense probably damaging 0.98
R8978:Myh2 UTSW 11 67,068,188 (GRCm39) missense probably damaging 0.96
R9228:Myh2 UTSW 11 67,077,522 (GRCm39) missense probably benign 0.11
R9332:Myh2 UTSW 11 67,070,209 (GRCm39) missense probably damaging 1.00
R9404:Myh2 UTSW 11 67,070,454 (GRCm39) missense probably damaging 1.00
R9430:Myh2 UTSW 11 67,070,359 (GRCm39) missense probably benign 0.01
R9445:Myh2 UTSW 11 67,069,754 (GRCm39) missense probably damaging 0.98
R9542:Myh2 UTSW 11 67,072,002 (GRCm39) missense possibly damaging 0.73
R9597:Myh2 UTSW 11 67,064,302 (GRCm39) missense possibly damaging 0.75
R9654:Myh2 UTSW 11 67,088,171 (GRCm39) missense probably benign
R9704:Myh2 UTSW 11 67,071,617 (GRCm39) missense possibly damaging 0.51
R9736:Myh2 UTSW 11 67,063,999 (GRCm39) missense probably benign 0.00
R9740:Myh2 UTSW 11 67,080,052 (GRCm39) missense probably damaging 0.99
X0026:Myh2 UTSW 11 67,065,848 (GRCm39) missense probably benign 0.10
X0065:Myh2 UTSW 11 67,067,085 (GRCm39) missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67,071,589 (GRCm39) critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67,082,275 (GRCm39) missense probably damaging 0.98
Z1177:Myh2 UTSW 11 67,084,084 (GRCm39) missense probably damaging 0.99
Z1177:Myh2 UTSW 11 67,066,997 (GRCm39) missense possibly damaging 0.86
Z1188:Myh2 UTSW 11 67,079,639 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGTGTCTCAATGATGGTTC -3'
(R):5'- GTGGTCACCCATAAAATGCTCTAG -3'

Sequencing Primer
(F):5'- TGATGGTTCATTACACAGGACACC -3'
(R):5'- CAATTGCTAACATAAAACAGTGAGAG -3'
Posted On 2021-04-30