Incidental Mutation 'R8762:Taf2'
ID 671872
Institutional Source Beutler Lab
Gene Symbol Taf2
Ensembl Gene ENSMUSG00000037343
Gene Name TATA-box binding protein associated factor 2
Synonyms 150kDa, TAFII150, CIF150, 4732460C16Rik, TAF2B
MMRRC Submission 068622-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8762 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 54878527-54935548 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 54910849 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 608 (N608K)
Ref Sequence ENSEMBL: ENSMUSP00000043733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041733]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041733
AA Change: N608K

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: N608K

DomainStartEndE-ValueType
Pfam:Peptidase_M1 21 406 5.6e-17 PFAM
SCOP:d1gw5a_ 606 973 6e-7 SMART
low complexity region 987 998 N/A INTRINSIC
low complexity region 1142 1175 N/A INTRINSIC
Meta Mutation Damage Score 0.1303 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A G 11: 101,301,226 (GRCm39) V272A probably benign Het
Acbd6 G A 1: 155,562,706 (GRCm39) E236K probably damaging Het
Actr1b T C 1: 36,748,909 (GRCm39) N9S probably benign Het
Adam17 A T 12: 21,401,595 (GRCm39) D133E probably benign Het
Adam6b G A 12: 113,453,227 (GRCm39) V15M probably damaging Het
Adam9 T A 8: 25,457,235 (GRCm39) N631I probably damaging Het
Albfm1 A G 5: 90,714,461 (GRCm39) N157S probably benign Het
Amy2a1 A T 3: 113,325,276 (GRCm39) probably benign Het
Aplnr A T 2: 84,967,515 (GRCm39) Y180F probably benign Het
Arhgef7 T C 8: 11,831,216 (GRCm39) V105A probably benign Het
Bambi G A 18: 3,511,277 (GRCm39) D33N probably damaging Het
Bicc1 G A 10: 70,779,216 (GRCm39) T724I probably benign Het
Brd2 T A 17: 34,335,934 (GRCm39) Q93L probably damaging Het
Cacnb2 A G 2: 14,972,759 (GRCm39) D222G possibly damaging Het
Cdh1 G T 8: 107,386,336 (GRCm39) D420Y probably damaging Het
Cep162 T C 9: 87,109,314 (GRCm39) S430G probably benign Het
Cfap161 T A 7: 83,443,282 (GRCm39) R27S possibly damaging Het
Chek1 C T 9: 36,629,636 (GRCm39) A237T probably benign Het
Chrna3 T A 9: 54,922,995 (GRCm39) K271M probably damaging Het
Coro7 A C 16: 4,452,203 (GRCm39) V410G probably benign Het
Crmp1 C A 5: 37,441,440 (GRCm39) N507K probably damaging Het
Crocc T C 4: 140,761,369 (GRCm39) R755G possibly damaging Het
Disc1 A G 8: 125,881,796 (GRCm39) D577G probably damaging Het
Dnah6 A G 6: 73,156,811 (GRCm39) Y649H possibly damaging Het
Flywch1 A G 17: 23,975,731 (GRCm39) S504P probably damaging Het
Fpr1 A T 17: 18,097,851 (GRCm39) V46D probably damaging Het
Fpr-rs7 C T 17: 20,333,789 (GRCm39) V234M probably benign Het
Ighv5-16 T C 12: 113,802,288 (GRCm39) N71D probably benign Het
Kash5 G T 7: 44,845,481 (GRCm39) D152E probably damaging Het
Kdm3b A G 18: 34,937,157 (GRCm39) M480V probably benign Het
L3mbtl3 T A 10: 26,152,121 (GRCm39) D825V probably damaging Het
Lef1 T A 3: 130,988,366 (GRCm39) M311K probably damaging Het
Magi1 T A 6: 93,792,789 (GRCm39) R150* probably null Het
Magi3 C T 3: 103,958,169 (GRCm39) V639I probably damaging Het
Mocos A T 18: 24,812,554 (GRCm39) R483W probably damaging Het
Mrps11 G T 7: 78,438,487 (GRCm39) V80F possibly damaging Het
Myh2 A T 11: 67,084,578 (GRCm39) R1706W probably damaging Het
Neurod6 T A 6: 55,656,228 (GRCm39) L136F probably damaging Het
Nfe2l1 A T 11: 96,711,306 (GRCm39) Y308N probably damaging Het
Nptn T A 9: 58,525,905 (GRCm39) probably benign Het
Or1e28-ps1 G T 11: 73,615,307 (GRCm39) T181N unknown Het
Or5g25 A T 2: 85,478,034 (GRCm39) S210R probably damaging Het
Oscar A G 7: 3,613,900 (GRCm39) S227P probably benign Het
Phgdh A C 3: 98,247,024 (GRCm39) I42R possibly damaging Het
Pla2g4a C T 1: 149,761,935 (GRCm39) G174D probably benign Het
Plcd4 A G 1: 74,591,213 (GRCm39) T203A possibly damaging Het
Plk3 ACACTCAC ACAC 4: 116,989,090 (GRCm39) probably benign Het
Plppr4 A T 3: 117,119,482 (GRCm39) V309D probably damaging Het
Pltp T C 2: 164,686,652 (GRCm39) K324E possibly damaging Het
Pml C T 9: 58,154,348 (GRCm39) R175H probably damaging Het
Psg20 C A 7: 18,408,557 (GRCm39) V388F probably benign Het
Qrfprl T C 6: 65,424,393 (GRCm39) V182A probably benign Het
Rabgef1 A G 5: 130,237,557 (GRCm39) D209G possibly damaging Het
Rif1 A T 2: 52,001,742 (GRCm39) N90I Het
Sec31a T C 5: 100,526,688 (GRCm39) H57R Het
Sidt1 T C 16: 44,152,707 (GRCm39) N62S probably benign Het
Slc18a2 T A 19: 59,261,355 (GRCm39) M172K probably benign Het
Slc34a3 T C 2: 25,121,003 (GRCm39) T362A probably benign Het
Smtn T G 11: 3,476,407 (GRCm39) D158A probably benign Het
Spen C T 4: 141,200,261 (GRCm39) V2789M probably damaging Het
Tctn3 A G 19: 40,595,636 (GRCm39) V383A unknown Het
Themis3 A T 17: 66,866,676 (GRCm39) M188K probably benign Het
Trpv5 A G 6: 41,652,313 (GRCm39) V124A probably benign Het
Tshr G A 12: 91,504,324 (GRCm39) V421M probably damaging Het
Ttn T A 2: 76,539,426 (GRCm39) D34520V probably benign Het
Ttn A C 2: 76,608,294 (GRCm39) Y17876* probably null Het
Zrsr2-ps1 T C 11: 22,923,694 (GRCm39) L156P probably benign Het
Other mutations in Taf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Taf2 APN 15 54,934,845 (GRCm39) critical splice acceptor site probably null
IGL00475:Taf2 APN 15 54,919,246 (GRCm39) nonsense probably null
IGL00549:Taf2 APN 15 54,894,511 (GRCm39) missense probably benign 0.03
IGL00839:Taf2 APN 15 54,909,174 (GRCm39) nonsense probably null
IGL01089:Taf2 APN 15 54,879,977 (GRCm39) missense probably benign
IGL01305:Taf2 APN 15 54,911,670 (GRCm39) missense probably damaging 0.99
IGL01532:Taf2 APN 15 54,912,882 (GRCm39) missense possibly damaging 0.94
IGL01903:Taf2 APN 15 54,923,412 (GRCm39) missense probably benign 0.03
IGL02324:Taf2 APN 15 54,891,772 (GRCm39) missense probably benign
IGL02328:Taf2 APN 15 54,891,772 (GRCm39) missense probably benign
IGL02405:Taf2 APN 15 54,897,551 (GRCm39) splice site probably benign
IGL02671:Taf2 APN 15 54,897,572 (GRCm39) missense probably benign 0.01
IGL02832:Taf2 APN 15 54,879,959 (GRCm39) missense probably benign 0.01
IGL03105:Taf2 APN 15 54,909,195 (GRCm39) missense probably benign 0.26
IGL03118:Taf2 APN 15 54,915,559 (GRCm39) missense probably damaging 1.00
ANU22:Taf2 UTSW 15 54,911,670 (GRCm39) missense probably damaging 0.99
R0104:Taf2 UTSW 15 54,901,734 (GRCm39) missense probably benign 0.02
R0104:Taf2 UTSW 15 54,901,734 (GRCm39) missense probably benign 0.02
R0183:Taf2 UTSW 15 54,919,186 (GRCm39) missense possibly damaging 0.89
R0326:Taf2 UTSW 15 54,910,856 (GRCm39) missense probably damaging 0.97
R0362:Taf2 UTSW 15 54,909,325 (GRCm39) missense probably damaging 1.00
R0423:Taf2 UTSW 15 54,928,078 (GRCm39) missense probably benign 0.02
R0562:Taf2 UTSW 15 54,885,584 (GRCm39) splice site probably benign
R0609:Taf2 UTSW 15 54,923,446 (GRCm39) missense probably damaging 1.00
R0655:Taf2 UTSW 15 54,901,690 (GRCm39) missense probably damaging 1.00
R0689:Taf2 UTSW 15 54,926,461 (GRCm39) missense possibly damaging 0.60
R0743:Taf2 UTSW 15 54,879,857 (GRCm39) small deletion probably benign
R0898:Taf2 UTSW 15 54,923,480 (GRCm39) missense probably damaging 0.97
R0969:Taf2 UTSW 15 54,894,553 (GRCm39) critical splice acceptor site probably null
R0974:Taf2 UTSW 15 54,879,857 (GRCm39) small deletion probably benign
R1145:Taf2 UTSW 15 54,879,857 (GRCm39) small deletion probably benign
R1145:Taf2 UTSW 15 54,879,857 (GRCm39) small deletion probably benign
R1160:Taf2 UTSW 15 54,934,793 (GRCm39) missense probably benign 0.01
R1376:Taf2 UTSW 15 54,879,857 (GRCm39) small deletion probably benign
R1388:Taf2 UTSW 15 54,900,021 (GRCm39) missense probably benign 0.00
R1416:Taf2 UTSW 15 54,901,806 (GRCm39) missense possibly damaging 0.95
R1458:Taf2 UTSW 15 54,923,311 (GRCm39) missense probably damaging 0.99
R1477:Taf2 UTSW 15 54,925,568 (GRCm39) missense possibly damaging 0.87
R1755:Taf2 UTSW 15 54,879,850 (GRCm39) missense probably damaging 1.00
R1766:Taf2 UTSW 15 54,934,793 (GRCm39) missense probably benign 0.01
R2090:Taf2 UTSW 15 54,879,882 (GRCm39) missense probably damaging 0.99
R2228:Taf2 UTSW 15 54,928,042 (GRCm39) missense possibly damaging 0.94
R2519:Taf2 UTSW 15 54,915,643 (GRCm39) missense probably benign 0.03
R4073:Taf2 UTSW 15 54,915,633 (GRCm39) missense probably damaging 1.00
R4470:Taf2 UTSW 15 54,922,276 (GRCm39) missense possibly damaging 0.70
R4471:Taf2 UTSW 15 54,922,276 (GRCm39) missense possibly damaging 0.70
R4472:Taf2 UTSW 15 54,922,276 (GRCm39) missense possibly damaging 0.70
R4716:Taf2 UTSW 15 54,929,364 (GRCm39) missense probably benign 0.02
R4937:Taf2 UTSW 15 54,890,619 (GRCm39) nonsense probably null
R5082:Taf2 UTSW 15 54,923,441 (GRCm39) missense probably benign 0.41
R5335:Taf2 UTSW 15 54,909,136 (GRCm39) missense probably benign 0.14
R5383:Taf2 UTSW 15 54,912,815 (GRCm39) missense possibly damaging 0.78
R5771:Taf2 UTSW 15 54,923,335 (GRCm39) missense probably benign 0.01
R5862:Taf2 UTSW 15 54,911,719 (GRCm39) missense possibly damaging 0.95
R5873:Taf2 UTSW 15 54,901,818 (GRCm39) missense probably benign 0.00
R5908:Taf2 UTSW 15 54,935,402 (GRCm39) unclassified probably benign
R6033:Taf2 UTSW 15 54,922,297 (GRCm39) missense probably damaging 1.00
R6033:Taf2 UTSW 15 54,922,297 (GRCm39) missense probably damaging 1.00
R6159:Taf2 UTSW 15 54,926,440 (GRCm39) missense possibly damaging 0.48
R6568:Taf2 UTSW 15 54,928,026 (GRCm39) missense probably damaging 1.00
R7094:Taf2 UTSW 15 54,923,482 (GRCm39) missense probably benign 0.27
R7174:Taf2 UTSW 15 54,912,135 (GRCm39) missense possibly damaging 0.51
R7241:Taf2 UTSW 15 54,925,537 (GRCm39) missense probably benign 0.01
R7561:Taf2 UTSW 15 54,919,229 (GRCm39) missense probably benign 0.16
R7583:Taf2 UTSW 15 54,928,072 (GRCm39) nonsense probably null
R7818:Taf2 UTSW 15 54,929,326 (GRCm39) missense probably benign
R7905:Taf2 UTSW 15 54,910,828 (GRCm39) missense possibly damaging 0.90
R8006:Taf2 UTSW 15 54,912,097 (GRCm39) missense probably damaging 1.00
R8017:Taf2 UTSW 15 54,928,013 (GRCm39) missense possibly damaging 0.66
R8019:Taf2 UTSW 15 54,928,013 (GRCm39) missense possibly damaging 0.66
R8119:Taf2 UTSW 15 54,894,526 (GRCm39) missense probably benign 0.00
R8127:Taf2 UTSW 15 54,923,384 (GRCm39) missense probably damaging 1.00
R8128:Taf2 UTSW 15 54,923,384 (GRCm39) missense probably damaging 1.00
R8129:Taf2 UTSW 15 54,923,384 (GRCm39) missense probably damaging 1.00
R8278:Taf2 UTSW 15 54,929,361 (GRCm39) nonsense probably null
R8290:Taf2 UTSW 15 54,926,416 (GRCm39) missense probably damaging 1.00
R8832:Taf2 UTSW 15 54,928,001 (GRCm39) missense possibly damaging 0.86
R8916:Taf2 UTSW 15 54,899,931 (GRCm39) missense probably benign 0.26
R8937:Taf2 UTSW 15 54,910,849 (GRCm39) missense probably benign 0.16
R9006:Taf2 UTSW 15 54,909,301 (GRCm39) missense possibly damaging 0.94
R9138:Taf2 UTSW 15 54,879,857 (GRCm39) small deletion probably benign
R9240:Taf2 UTSW 15 54,926,464 (GRCm39) missense probably null 1.00
R9257:Taf2 UTSW 15 54,929,409 (GRCm39) missense possibly damaging 0.46
R9485:Taf2 UTSW 15 54,911,667 (GRCm39) missense probably benign 0.05
R9762:Taf2 UTSW 15 54,894,440 (GRCm39) critical splice donor site probably null
R9766:Taf2 UTSW 15 54,910,881 (GRCm39) critical splice acceptor site probably null
R9796:Taf2 UTSW 15 54,910,832 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATTGCCCTAAGTCGCATGC -3'
(R):5'- GTTTTCACACTCCATGTCAGTG -3'

Sequencing Primer
(F):5'- CCCTAAGTCGCATGCATATCAATGTG -3'
(R):5'- ATGTCAGTGTTCACTCCACTTTG -3'
Posted On 2021-04-30