Incidental Mutation 'R8762:Slc18a2'
ID671884
Institutional Source Beutler Lab
Gene Symbol Slc18a2
Ensembl Gene ENSMUSG00000025094
Gene Namesolute carrier family 18 (vesicular monoamine), member 2
SynonymsVmat2, 1110037L13Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8762 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location59260878-59296012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59272923 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 172 (M172K)
Ref Sequence ENSEMBL: ENSMUSP00000026084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026084]
Predicted Effect probably benign
Transcript: ENSMUST00000026084
AA Change: M172K

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026084
Gene: ENSMUSG00000025094
AA Change: M172K

DomainStartEndE-ValueType
Pfam:MFS_1 22 428 6.8e-40 PFAM
Pfam:Sugar_tr 26 284 5.9e-10 PFAM
Pfam:MFS_2 127 457 4.3e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The vesicular monoamine transporter acts to accumulate cytosolic monoamines into synaptic vesicles, using the proton gradient maintained across the synaptic vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (summary by Peter et al., 1993 [PubMed 7905859]). See also SLC18A1 (MIM 193002).[supplied by OMIM, Jan 2011]
PHENOTYPE: Nullizygous mice exhibit early postnatal death accompanied by reduced body size, hypokinesia, and reduced brain monoamine levels. Hypomorphic mutants show impaired olfaction, gastroparesis, altered sleep latency, neuron degeneration, enhanced MPTP sensitivity, anxiety- and depressive-like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,566,602 N157S probably benign Het
Aarsd1 A G 11: 101,410,400 V272A probably benign Het
Acbd6 G A 1: 155,686,960 E236K probably damaging Het
Actr1b T C 1: 36,709,828 N9S probably benign Het
Adam17 A T 12: 21,351,594 D133E probably benign Het
Adam6b G A 12: 113,489,607 V15M probably damaging Het
Adam9 T A 8: 24,967,219 N631I probably damaging Het
Amy2a1 A T 3: 113,531,627 probably benign Het
Aplnr A T 2: 85,137,171 Y180F probably benign Het
Arhgef7 T C 8: 11,781,216 V105A probably benign Het
Bambi G A 18: 3,511,277 D33N probably damaging Het
Bicc1 G A 10: 70,943,386 T724I probably benign Het
Brd2 T A 17: 34,116,960 Q93L probably damaging Het
C130060K24Rik T C 6: 65,447,409 V182A probably benign Het
Cacnb2 A G 2: 14,967,948 D222G possibly damaging Het
Ccdc155 G T 7: 45,196,057 D152E probably damaging Het
Cdh1 G T 8: 106,659,704 D420Y probably damaging Het
Cep162 T C 9: 87,227,261 S430G probably benign Het
Cfap161 T A 7: 83,794,074 R27S possibly damaging Het
Chek1 C T 9: 36,718,340 A237T probably benign Het
Chrna3 T A 9: 55,015,711 K271M probably damaging Het
Coro7 A C 16: 4,634,339 V410G probably benign Het
Crmp1 C A 5: 37,284,096 N507K probably damaging Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Disc1 A G 8: 125,155,057 D577G probably damaging Het
Dnah6 A G 6: 73,179,828 Y649H possibly damaging Het
Flywch1 A G 17: 23,756,757 S504P probably damaging Het
Fpr1 A T 17: 17,877,589 V46D probably damaging Het
Fpr-rs7 C T 17: 20,113,527 V234M probably benign Het
Ighv5-16 T C 12: 113,838,668 N71D probably benign Het
Kdm3b A G 18: 34,804,104 M480V probably benign Het
L3mbtl3 T A 10: 26,276,223 D825V probably damaging Het
Lef1 T A 3: 131,194,717 M311K probably damaging Het
Magi1 T A 6: 93,815,808 R150* probably null Het
Magi3 C T 3: 104,050,853 V639I probably damaging Het
Mocos A T 18: 24,679,497 R483W probably damaging Het
Mrps11 G T 7: 78,788,739 V80F possibly damaging Het
Myh2 A T 11: 67,193,752 R1706W probably damaging Het
Neurod6 T A 6: 55,679,243 L136F probably damaging Het
Nfe2l1 A T 11: 96,820,480 Y308N probably damaging Het
Olfr1002 A T 2: 85,647,690 S210R probably damaging Het
Olfr388-ps1 G T 11: 73,724,481 T181N unknown Het
Oscar A G 7: 3,610,901 S227P probably benign Het
Phgdh A C 3: 98,339,708 I42R possibly damaging Het
Pla2g4a C T 1: 149,886,184 G174D probably benign Het
Plcd4 A G 1: 74,552,054 T203A possibly damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Plppr4 A T 3: 117,325,833 V309D probably damaging Het
Pltp T C 2: 164,844,732 K324E possibly damaging Het
Pml C T 9: 58,247,065 R175H probably damaging Het
Psg20 C A 7: 18,674,632 V388F probably benign Het
Rabgef1 A G 5: 130,208,716 D209G possibly damaging Het
Rif1 A T 2: 52,111,730 N90I Het
Sec31a T C 5: 100,378,829 H57R Het
Sidt1 T C 16: 44,332,344 N62S probably benign Het
Slc34a3 T C 2: 25,230,991 T362A probably benign Het
Smtn T G 11: 3,526,407 D158A probably benign Het
Spen C T 4: 141,472,950 V2789M probably damaging Het
Taf2 A T 15: 55,047,453 N608K probably benign Het
Tctn3 A G 19: 40,607,192 V383A unknown Het
Themis3 A T 17: 66,559,681 M188K probably benign Het
Trpv5 A G 6: 41,675,379 V124A probably benign Het
Tshr G A 12: 91,537,550 V421M probably damaging Het
Ttn T A 2: 76,709,082 D34520V probably benign Het
Ttn A C 2: 76,777,950 Y17876* probably null Het
Zrsr1 T C 11: 22,973,694 L156P probably benign Het
Other mutations in Slc18a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Slc18a2 APN 19 59284384 missense probably benign 0.02
IGL01956:Slc18a2 APN 19 59287176 splice site probably benign
IGL02220:Slc18a2 APN 19 59276556 missense probably benign 0.01
IGL02389:Slc18a2 APN 19 59263301 splice site probably benign
IGL02795:Slc18a2 APN 19 59274490 splice site probably benign
PIT4585001:Slc18a2 UTSW 19 59293861 missense possibly damaging 0.47
R0373:Slc18a2 UTSW 19 59287367 missense probably benign
R1972:Slc18a2 UTSW 19 59274653 missense possibly damaging 0.89
R2018:Slc18a2 UTSW 19 59276505 missense possibly damaging 0.90
R3508:Slc18a2 UTSW 19 59273557 missense probably benign 0.03
R5313:Slc18a2 UTSW 19 59293843 missense probably benign 0.04
R5574:Slc18a2 UTSW 19 59261405 missense probably benign 0.09
R6102:Slc18a2 UTSW 19 59293878 missense probably benign 0.00
R7569:Slc18a2 UTSW 19 59284152 missense probably damaging 0.96
R7607:Slc18a2 UTSW 19 59284358 missense probably benign 0.43
R7818:Slc18a2 UTSW 19 59263161 missense probably benign
R8059:Slc18a2 UTSW 19 59284140 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAAGGTCACGTAGGAAGCCC -3'
(R):5'- GAACCCTCCCTTAAACTCATGAGTG -3'

Sequencing Primer
(F):5'- TCACGTAGGAAGCCCTGAGTATATG -3'
(R):5'- ACTCATGAGTGTATCTATACTTGAGG -3'
Posted On2021-04-30