Incidental Mutation 'R8804:B4galt3'
ID 671890
Institutional Source Beutler Lab
Gene Symbol B4galt3
Ensembl Gene ENSMUSG00000052423
Gene Name UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
Synonyms ESTM26, 9530061M23Rik, beta4GalT-III, R74981
MMRRC Submission 068641-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.454) question?
Stock # R8804 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 171097898-171104468 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 171103947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 395 (H395Y)
Ref Sequence ENSEMBL: ENSMUSP00000066353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064272] [ENSMUST00000073120] [ENSMUST00000111313] [ENSMUST00000126699] [ENSMUST00000141114] [ENSMUST00000141999] [ENSMUST00000151863] [ENSMUST00000192956]
AlphaFold Q91YY2
Predicted Effect probably benign
Transcript: ENSMUST00000064272
AA Change: H395Y

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066353
Gene: ENSMUSG00000052423
AA Change: H395Y

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 212 1.7e-59 PFAM
Pfam:Glyco_transf_7C 217 294 6.3e-32 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073120
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111313
AA Change: H395Y

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106945
Gene: ENSMUSG00000052423
AA Change: H395Y

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 214 2.1e-74 PFAM
Pfam:Glyco_transf_7C 217 294 1.7e-31 PFAM
Pfam:Glyco_tranf_2_2 238 298 1e-6 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126699
AA Change: H173Y

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141958
Gene: ENSMUSG00000052423
AA Change: H173Y

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 1 72 3.2e-28 PFAM
Pfam:Glyco_tranf_2_2 16 76 2.1e-5 PFAM
low complexity region 126 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141114
SMART Domains Protein: ENSMUSP00000114560
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:Glyco_transf_7N 104 139 2.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141999
SMART Domains Protein: ENSMUSP00000114926
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151863
Predicted Effect probably benign
Transcript: ENSMUST00000192956
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,682,820 (GRCm39) probably benign Het
Adamts1 A G 16: 85,599,300 (GRCm39) F100S probably damaging Het
Adamts5 A G 16: 85,666,800 (GRCm39) probably benign Het
Adgrb2 T A 4: 129,899,212 (GRCm39) W309R probably damaging Het
Adgrl2 A T 3: 148,552,652 (GRCm39) V617E probably damaging Het
Akt1 T C 12: 112,625,041 (GRCm39) E169G probably damaging Het
Arhgap40 A G 2: 158,389,626 (GRCm39) T600A probably benign Het
BC024139 T G 15: 76,008,284 (GRCm39) T376P possibly damaging Het
Bin3 A G 14: 70,361,296 (GRCm39) R22G probably damaging Het
Cadps2 A T 6: 23,496,805 (GRCm39) I480N probably damaging Het
Camsap3 A G 8: 3,652,624 (GRCm39) T401A probably benign Het
Ccdc168 T C 1: 44,095,809 (GRCm39) N1763S probably benign Het
Cdhr5 T C 7: 140,849,320 (GRCm39) T747A probably benign Het
Chn2 A G 6: 54,250,061 (GRCm39) I193V probably benign Het
Clca3b T C 3: 144,544,898 (GRCm39) N363S probably benign Het
Clec7a T C 6: 129,442,518 (GRCm39) T125A probably benign Het
Cys1 A T 12: 24,718,610 (GRCm39) L81Q unknown Het
Dcbld2 G A 16: 58,281,412 (GRCm39) probably benign Het
Ddx60 T A 8: 62,411,640 (GRCm39) D497E probably benign Het
Dnah2 T C 11: 69,356,511 (GRCm39) I2117V probably benign Het
Dnah6 G A 6: 73,042,756 (GRCm39) S3274F probably benign Het
Dock9 A T 14: 121,842,595 (GRCm39) I1225N probably damaging Het
Egfr A G 11: 16,819,339 (GRCm39) T290A probably benign Het
Elmod2 T A 8: 84,046,150 (GRCm39) K142N probably benign Het
Ephx2 T C 14: 66,324,469 (GRCm39) T441A probably benign Het
Fam234a A G 17: 26,435,531 (GRCm39) probably benign Het
Fer1l4 C A 2: 155,893,914 (GRCm39) E102D probably benign Het
Fermt3 A G 19: 6,991,694 (GRCm39) probably benign Het
Fgd5 C T 6: 91,964,507 (GRCm39) R247C probably benign Het
Gm14443 G A 2: 175,011,652 (GRCm39) H265Y probably damaging Het
Gykl1 A G 18: 52,827,608 (GRCm39) D272G probably benign Het
Hip1r T C 5: 124,139,575 (GRCm39) S952P possibly damaging Het
Hmcn2 A G 2: 31,315,393 (GRCm39) N3714S probably benign Het
Ighv1-36 G T 12: 114,843,581 (GRCm39) T93K probably benign Het
Igsf10 T G 3: 59,243,876 (GRCm39) T153P probably damaging Het
Kif13b T C 14: 64,987,791 (GRCm39) C773R probably damaging Het
Lipf T A 19: 33,942,198 (GRCm39) Y43N probably damaging Het
Mlh1 T C 9: 111,093,972 (GRCm39) D90G probably damaging Het
Msh5 A T 17: 35,251,830 (GRCm39) I410K probably benign Het
Mylk3 T C 8: 86,085,874 (GRCm39) D220G probably benign Het
Ncdn G A 4: 126,643,898 (GRCm39) A308V probably benign Het
Nfu1 T A 6: 86,993,414 (GRCm39) probably benign Het
Nup153 A G 13: 46,840,635 (GRCm39) V991A probably benign Het
Nup188 T A 2: 30,220,891 (GRCm39) H960Q probably benign Het
Parp4 G T 14: 56,853,900 (GRCm39) E839* probably null Het
Pfas T C 11: 68,881,908 (GRCm39) N30D Het
Pitpnc1 T A 11: 107,103,431 (GRCm39) N223Y probably damaging Het
Plaat1 T A 16: 29,039,205 (GRCm39) V95E probably benign Het
Plod1 C T 4: 147,997,778 (GRCm39) V644I probably damaging Het
Pou2f1 T C 1: 165,708,039 (GRCm39) T548A unknown Het
Psg20 A T 7: 18,416,584 (GRCm39) N177K possibly damaging Het
Psmb8 T A 17: 34,419,225 (GRCm39) I173N probably damaging Het
Rimkla G A 4: 119,325,273 (GRCm39) Q379* probably null Het
Rnasel G T 1: 153,629,661 (GRCm39) G59V probably damaging Het
Rptn A T 3: 93,303,150 (GRCm39) D161V probably damaging Het
Scrt1 C A 15: 76,403,411 (GRCm39) C193F unknown Het
Sdk2 G T 11: 113,763,978 (GRCm39) Y269* probably null Het
Sfxn2 G C 19: 46,574,243 (GRCm39) probably benign Het
Slc17a4 G T 13: 24,087,245 (GRCm39) T264K probably benign Het
Slfn8 T A 11: 82,907,639 (GRCm39) Q301H possibly damaging Het
Sntb1 G A 15: 55,655,523 (GRCm39) S231F probably benign Het
Spag17 T A 3: 99,874,506 (GRCm39) S137T probably benign Het
Srd5a2 A T 17: 74,354,629 (GRCm39) V65E possibly damaging Het
Stk11ip A G 1: 75,511,900 (GRCm39) H967R probably benign Het
Sun1 A G 5: 139,216,920 (GRCm39) T320A probably benign Het
Svep1 A G 4: 58,206,043 (GRCm39) S112P possibly damaging Het
Tacc2 T C 7: 130,294,693 (GRCm39) L15P probably benign Het
Tas2r140 T A 6: 133,032,326 (GRCm39) N144I probably damaging Het
Thpo T A 16: 20,544,707 (GRCm39) R174S probably damaging Het
Tnik A T 3: 28,648,202 (GRCm39) Q418L unknown Het
Tnr A T 1: 159,685,882 (GRCm39) Q371L probably benign Het
Tulp2 G A 7: 45,170,398 (GRCm39) R439Q probably damaging Het
Uchl4 G T 9: 64,142,606 (GRCm39) W29L probably damaging Het
Vrk3 T A 7: 44,407,270 (GRCm39) C80* probably null Het
Washc4 T C 10: 83,408,015 (GRCm39) L540P probably damaging Het
Wscd1 T C 11: 71,675,161 (GRCm39) F356S probably damaging Het
Wwc1 A T 11: 35,774,144 (GRCm39) M372K probably benign Het
Zfhx2 A G 14: 55,312,191 (GRCm39) F168L probably benign Het
Zfp28 A G 7: 6,393,399 (GRCm39) D175G probably damaging Het
Other mutations in B4galt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:B4galt3 APN 1 171,099,362 (GRCm39) missense probably damaging 1.00
BB004:B4galt3 UTSW 1 171,099,342 (GRCm39) nonsense probably null
BB014:B4galt3 UTSW 1 171,099,342 (GRCm39) nonsense probably null
R0026:B4galt3 UTSW 1 171,101,831 (GRCm39) unclassified probably benign
R0126:B4galt3 UTSW 1 171,103,738 (GRCm39) missense probably damaging 0.97
R0537:B4galt3 UTSW 1 171,101,821 (GRCm39) unclassified probably benign
R1478:B4galt3 UTSW 1 171,103,938 (GRCm39) missense probably benign 0.11
R2012:B4galt3 UTSW 1 171,100,118 (GRCm39) missense probably damaging 1.00
R2206:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2207:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2223:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2353:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2354:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2438:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2439:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3039:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3051:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3709:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3710:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3741:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3742:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3813:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3953:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4058:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4059:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4323:B4galt3 UTSW 1 171,103,515 (GRCm39) missense possibly damaging 0.93
R4367:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4368:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4370:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4371:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4486:B4galt3 UTSW 1 171,099,343 (GRCm39) missense possibly damaging 0.94
R4538:B4galt3 UTSW 1 171,100,280 (GRCm39) missense probably damaging 1.00
R5557:B4galt3 UTSW 1 171,100,089 (GRCm39) critical splice acceptor site probably null
R7313:B4galt3 UTSW 1 171,100,319 (GRCm39) missense probably damaging 1.00
R7927:B4galt3 UTSW 1 171,099,342 (GRCm39) nonsense probably null
R8222:B4galt3 UTSW 1 171,100,253 (GRCm39) missense possibly damaging 0.46
R8552:B4galt3 UTSW 1 171,101,917 (GRCm39) missense possibly damaging 0.70
R8859:B4galt3 UTSW 1 171,099,241 (GRCm39) missense unknown
R9150:B4galt3 UTSW 1 171,103,899 (GRCm39) missense probably benign
R9265:B4galt3 UTSW 1 171,101,617 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGGTCCTCTCTATACCAAC -3'
(R):5'- GTCATAAGCCCTGACAGGTG -3'

Sequencing Primer
(F):5'- GGGTCCTCTCTATACCAACATCAC -3'
(R):5'- CTGACAGGTGACCCCTAGAAAG -3'
Posted On 2021-04-30