Incidental Mutation 'R8804:Clca3b'
ID671901
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Namechloride channel accessory 3B
SynonymsClca4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8804 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location144822623-144849357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144839137 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 363 (N363S)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
Predicted Effect probably benign
Transcript: ENSMUST00000159989
AA Change: N363S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: N363S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,628,656 probably benign Het
Adamts1 A G 16: 85,802,412 F100S probably damaging Het
Adamts5 A G 16: 85,869,912 probably benign Het
Adgrb2 T A 4: 130,005,419 W309R probably damaging Het
Adgrl2 A T 3: 148,847,016 V617E probably damaging Het
Akt1 T C 12: 112,658,607 E169G probably damaging Het
Arhgap40 A G 2: 158,547,706 T600A probably benign Het
B4galt3 C T 1: 171,276,374 H395Y probably benign Het
BC024139 T G 15: 76,124,084 T376P possibly damaging Het
Bin3 A G 14: 70,123,847 R22G probably damaging Het
Cadps2 A T 6: 23,496,806 I480N probably damaging Het
Camsap3 A G 8: 3,602,624 T401A probably benign Het
Cdhr5 T C 7: 141,269,407 T747A probably benign Het
Chn2 A G 6: 54,273,076 I193V probably benign Het
Clec7a T C 6: 129,465,555 T125A probably benign Het
Cys1 A T 12: 24,668,611 L81Q unknown Het
Dcbld2 G A 16: 58,461,049 probably benign Het
Ddx60 T A 8: 61,958,606 D497E probably benign Het
Dnah2 T C 11: 69,465,685 I2117V probably benign Het
Dnah6 G A 6: 73,065,773 S3274F probably benign Het
Dock9 A T 14: 121,605,183 I1225N probably damaging Het
Egfr A G 11: 16,869,339 T290A probably benign Het
Elmod2 T A 8: 83,319,521 K142N probably benign Het
Ephx2 T C 14: 66,087,020 T441A probably benign Het
Fam234a A G 17: 26,216,557 probably benign Het
Fer1l4 C A 2: 156,051,994 E102D probably benign Het
Fermt3 A G 19: 7,014,326 probably benign Het
Fgd5 C T 6: 91,987,526 R247C probably benign Het
Gm14443 G A 2: 175,169,859 H265Y probably damaging Het
Gm8251 T C 1: 44,056,649 N1763S probably benign Het
Gykl1 A G 18: 52,694,536 D272G probably benign Het
Hip1r T C 5: 124,001,512 S952P possibly damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Hrasls T A 16: 29,220,453 V95E probably benign Het
Ighv1-36 G T 12: 114,879,961 T93K probably benign Het
Igsf10 T G 3: 59,336,455 T153P probably damaging Het
Kif13b T C 14: 64,750,342 C773R probably damaging Het
Lipf T A 19: 33,964,798 Y43N probably damaging Het
Mlh1 T C 9: 111,264,904 D90G probably damaging Het
Msh5 A T 17: 35,032,854 I410K probably benign Het
Mylk3 T C 8: 85,359,245 D220G probably benign Het
Ncdn G A 4: 126,750,105 A308V probably benign Het
Nup153 A G 13: 46,687,159 V991A probably benign Het
Nup188 T A 2: 30,330,879 H960Q probably benign Het
Parp4 G T 14: 56,616,443 E839* probably null Het
Pfas T C 11: 68,991,082 N30D Het
Pitpnc1 T A 11: 107,212,605 N223Y probably damaging Het
Plod1 C T 4: 147,913,321 V644I probably damaging Het
Pou2f1 T C 1: 165,880,470 T548A unknown Het
Psg20 A T 7: 18,682,659 N177K possibly damaging Het
Psmb8 T A 17: 34,200,251 I173N probably damaging Het
Rimkla G A 4: 119,468,076 Q379* probably null Het
Rnasel G T 1: 153,753,915 G59V probably damaging Het
Rptn A T 3: 93,395,843 D161V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Scrt1 C A 15: 76,519,211 C193F unknown Het
Sdk2 G T 11: 113,873,152 Y269* probably null Het
Sfxn2 G C 19: 46,585,804 probably benign Het
Slc17a4 G T 13: 23,903,262 T264K probably benign Het
Slfn8 T A 11: 83,016,813 Q301H possibly damaging Het
Sntb1 G A 15: 55,792,127 S231F probably benign Het
Spag17 T A 3: 99,967,190 S137T probably benign Het
Srd5a2 A T 17: 74,047,634 V65E possibly damaging Het
Stk11ip A G 1: 75,535,256 H967R probably benign Het
Sun1 A G 5: 139,231,165 T320A probably benign Het
Svep1 A G 4: 58,206,043 S112P possibly damaging Het
Tacc2 T C 7: 130,692,963 L15P probably benign Het
Tas2r140 T A 6: 133,055,363 N144I probably damaging Het
Thpo T A 16: 20,725,957 R174S probably damaging Het
Tnik A T 3: 28,594,053 Q418L unknown Het
Tnr A T 1: 159,858,312 Q371L probably benign Het
Tulp2 G A 7: 45,520,974 R439Q probably damaging Het
Uchl4 G T 9: 64,235,324 W29L probably damaging Het
Vrk3 T A 7: 44,757,846 C80* probably null Het
Washc4 T C 10: 83,572,151 L540P probably damaging Het
Wscd1 T C 11: 71,784,335 F356S probably damaging Het
Wwc1 A T 11: 35,883,317 M372K probably benign Het
Zfhx2 A G 14: 55,074,734 F168L probably benign Het
Zfp28 A G 7: 6,390,400 D175G probably damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0524:Clca3b UTSW 3 144825321 missense probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4355:Clca3b UTSW 3 144825458 splice site probably null
R4691:Clca3b UTSW 3 144839092 missense probably benign 0.02
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R4845:Clca3b UTSW 3 144825270 missense probably benign
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5572:Clca3b UTSW 3 144827309 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R5845:Clca3b UTSW 3 144825316 missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144841420 missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144836656 nonsense probably null
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
R7798:Clca3b UTSW 3 144828130 missense probably damaging 1.00
R8008:Clca3b UTSW 3 144844609 missense probably benign 0.44
R8132:Clca3b UTSW 3 144847174 missense probably benign 0.13
R8181:Clca3b UTSW 3 144839137 missense probably benign 0.00
R8305:Clca3b UTSW 3 144825937 missense probably damaging 1.00
R8546:Clca3b UTSW 3 144827397 missense probably damaging 0.99
R8716:Clca3b UTSW 3 144844594 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CCCTTGGTGAGAGTTGAAGAAG -3'
(R):5'- TAAAGATACTCCAGAGTTGCTCTC -3'

Sequencing Primer
(F):5'- CCTTGGTGAGAGTTGAAGAAGTCATC -3'
(R):5'- TCCAGAGTTGCTCTCATATATATGC -3'
Posted On2021-04-30